Incidental Mutation 'R1977:Asah1'
ID221864
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene NameN-acylsphingosine amidohydrolase 1
Synonymsacid ceramidase, 2310081N20Rik
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41340197-41374773 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41343517 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417]
Predicted Effect probably null
Transcript: ENSMUST00000034000
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110417
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131796
Meta Mutation Damage Score 0.432 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41349543 unclassified probably benign
IGL02512:Asah1 APN 8 41360307 intron probably benign
IGL02523:Asah1 APN 8 41351947 missense probably benign
IGL03115:Asah1 APN 8 41360299 missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41346196 splice site probably benign
R0593:Asah1 UTSW 8 41349582 missense probably benign 0.02
R1451:Asah1 UTSW 8 41354012 critical splice donor site probably null
R2200:Asah1 UTSW 8 41343728 critical splice donor site probably null
R3429:Asah1 UTSW 8 41351888 unclassified probably benign
R4002:Asah1 UTSW 8 41348139 splice site probably benign
R4078:Asah1 UTSW 8 41354082 missense probably damaging 0.99
R4470:Asah1 UTSW 8 41343724 splice site probably null
R4471:Asah1 UTSW 8 41343724 splice site probably null
R4968:Asah1 UTSW 8 41354030 missense possibly damaging 0.89
R4970:Asah1 UTSW 8 41360277 nonsense probably null
R5643:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41354055 missense probably damaging 1.00
R6419:Asah1 UTSW 8 41343766 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAAACAAAGGTGACTATTC -3'
(R):5'- GAACCCAGGCCAATGTGAAG -3'

Sequencing Primer
(F):5'- TGCCTGACATTAACTTAAGGAGG -3'
(R):5'- CCAGGCCAATGTGAAGCCTAAG -3'
Posted On2014-08-25