Incidental Mutation 'R1978:Crisp4'
ID221925
Institutional Source Beutler Lab
Gene Symbol Crisp4
Ensembl Gene ENSMUSG00000025774
Gene Namecysteine-rich secretory protein 4
Synonyms
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location18115191-18145902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18128665 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 143 (I143V)
Ref Sequence ENSEMBL: ENSMUSP00000026876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026876] [ENSMUST00000115340] [ENSMUST00000115344]
Predicted Effect probably benign
Transcript: ENSMUST00000026876
AA Change: I143V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026876
Gene: ENSMUSG00000025774
AA Change: I143V

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
SCP 44 188 1.32e-45 SMART
Pfam:Crisp 200 254 4.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115340
AA Change: I139V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110997
Gene: ENSMUSG00000025774
AA Change: I139V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCP 40 184 1.32e-45 SMART
Pfam:Crisp 196 250 6.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115344
AA Change: I182V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111001
Gene: ENSMUSG00000025774
AA Change: I182V

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
SCP 83 227 1.32e-45 SMART
Pfam:Crisp 239 293 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a null mutation display an impaired acrosome reaction in response to progesterone but are fertile with normal testis morphology and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Crisp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Crisp4 APN 1 18128647 missense probably damaging 1.00
IGL01071:Crisp4 APN 1 18137007 missense probably benign 0.41
IGL01641:Crisp4 APN 1 18124290 missense possibly damaging 0.91
IGL01670:Crisp4 APN 1 18128677 missense probably benign 0.03
IGL01985:Crisp4 APN 1 18134065 missense probably damaging 1.00
IGL02043:Crisp4 APN 1 18134100 missense probably damaging 1.00
R1241:Crisp4 UTSW 1 18122794 missense probably damaging 1.00
R5269:Crisp4 UTSW 1 18128710 missense probably damaging 1.00
R5736:Crisp4 UTSW 1 18115715 missense probably benign 0.03
R6154:Crisp4 UTSW 1 18122788 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCGTTTGCACTGTCAGTCAAG -3'
(R):5'- GCCTAGGTGATCATGAAAACATTTGG -3'

Sequencing Primer
(F):5'- GCACTGTCAGTCAAGTGGTATTATC -3'
(R):5'- TTTGGGAAATAAAATGAGGAGATCC -3'
Posted On2014-08-25