Incidental Mutation 'R2046:4930402H24Rik'
ID221930
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene NameRIKEN cDNA 4930402H24 gene
Synonyms
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130706200-130906406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130810917 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 42 (I42L)
Ref Sequence ENSEMBL: ENSMUSP00000113481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000110243] [ENSMUST00000119422] [ENSMUST00000120316] [ENSMUST00000138990] [ENSMUST00000146975]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044766
AA Change: I173L

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309
AA Change: I173L

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110243
AA Change: I173L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105872
Gene: ENSMUSG00000027309
AA Change: I173L

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119422
AA Change: I42L

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309
AA Change: I42L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120316
AA Change: I42L
SMART Domains Protein: ENSMUSP00000112540
Gene: ENSMUSG00000027309
AA Change: I42L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123049
Predicted Effect unknown
Transcript: ENSMUST00000138990
AA Change: I42L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144014
Predicted Effect probably benign
Transcript: ENSMUST00000146975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148924
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2374:4930402H24Rik UTSW 2 130820574 missense probably damaging 1.00
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R3907:4930402H24Rik UTSW 2 130736576 missense probably damaging 0.99
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6732:4930402H24Rik UTSW 2 130810820 critical splice donor site probably null
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCACACGGCTAACATACC -3'
(R):5'- GAGAAAGCTGATTGGCTGGC -3'

Sequencing Primer
(F):5'- CCTGATCTGCACAGTGAAACCTTG -3'
(R):5'- ATTGGCTGGCTTTGGATAAAAG -3'
Posted On2014-08-25