Incidental Mutation 'R2046:Trim2'
ID221932
Institutional Source Beutler Lab
Gene Symbol Trim2
Ensembl Gene ENSMUSG00000027993
Gene Nametripartite motif-containing 2
Synonymsneural activity-related ring finger protein, narf
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location84160439-84306877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84208289 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 86 (L86P)
Ref Sequence ENSEMBL: ENSMUSP00000118888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054990] [ENSMUST00000065380] [ENSMUST00000107691] [ENSMUST00000107692] [ENSMUST00000107693] [ENSMUST00000107695] [ENSMUST00000122849] [ENSMUST00000132283] [ENSMUST00000147901] [ENSMUST00000154152]
Predicted Effect probably damaging
Transcript: ENSMUST00000054990
AA Change: L112P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049902
Gene: ENSMUSG00000027993
AA Change: L112P

DomainStartEndE-ValueType
RING 49 89 3.5e-9 SMART
BBOX 139 180 3.52e-14 SMART
BBC 187 313 1.7e-38 SMART
IG_FLMN 350 450 2.41e-30 SMART
Pfam:NHL 512 539 2e-8 PFAM
Pfam:NHL 559 586 1.1e-8 PFAM
Pfam:NHL 601 628 2.1e-7 PFAM
Pfam:NHL 648 675 5.8e-10 PFAM
Pfam:NHL 695 722 3.5e-12 PFAM
Pfam:NHL 739 766 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065380
AA Change: L86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069922
Gene: ENSMUSG00000027993
AA Change: L86P

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107691
AA Change: L86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103319
Gene: ENSMUSG00000027993
AA Change: L86P

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107692
AA Change: L86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103320
Gene: ENSMUSG00000027993
AA Change: L86P

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107693
AA Change: L86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103321
Gene: ENSMUSG00000027993
AA Change: L86P

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107695
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103323
Gene: ENSMUSG00000027993
AA Change: L103P

DomainStartEndE-ValueType
RING 40 80 3.5e-9 SMART
BBOX 130 171 3.52e-14 SMART
BBC 178 304 1.7e-38 SMART
IG_FLMN 341 441 2.41e-30 SMART
Pfam:NHL 503 530 9.1e-8 PFAM
Pfam:NHL 550 577 7.5e-8 PFAM
Pfam:NHL 592 619 1.2e-6 PFAM
Pfam:NHL 639 666 6.3e-9 PFAM
Pfam:NHL 686 713 4.7e-12 PFAM
Pfam:NHL 730 757 5.8e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122849
AA Change: L104P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120981
Gene: ENSMUSG00000027993
AA Change: L104P

DomainStartEndE-ValueType
RING 41 81 3.5e-9 SMART
BBOX 131 172 3.52e-14 SMART
Blast:BBC 179 213 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128574
Predicted Effect probably damaging
Transcript: ENSMUST00000132283
AA Change: L86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118888
Gene: ENSMUSG00000027993
AA Change: L86P

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
Blast:BBC 161 191 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140856
Predicted Effect probably damaging
Transcript: ENSMUST00000147901
AA Change: L86P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121055
Gene: ENSMUSG00000027993
AA Change: L86P

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154152
SMART Domains Protein: ENSMUSP00000115914
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 39 70 9.3e-6 SMART
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit tremors, ataxia and seizures associated with neurodegeneration of Purkinje cells, deep cerebellar nuclei and retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in Trim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trim2 APN 3 84208289 missense probably damaging 1.00
IGL01658:Trim2 APN 3 84210285 missense probably benign 0.33
IGL02943:Trim2 APN 3 84178176 missense probably benign 0.45
PIT4142001:Trim2 UTSW 3 84190857 missense probably benign 0.00
R0149:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R0158:Trim2 UTSW 3 84210169 splice site probably benign
R0361:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R1270:Trim2 UTSW 3 84167677 missense probably damaging 1.00
R1651:Trim2 UTSW 3 84167650 critical splice donor site probably null
R1756:Trim2 UTSW 3 84190800 missense possibly damaging 0.52
R1938:Trim2 UTSW 3 84177792 missense possibly damaging 0.94
R2192:Trim2 UTSW 3 84190918 nonsense probably null
R3696:Trim2 UTSW 3 84190851 missense probably benign 0.05
R4981:Trim2 UTSW 3 84177735 missense probably damaging 1.00
R5389:Trim2 UTSW 3 84167653 missense probably null 0.60
R5735:Trim2 UTSW 3 84167722 missense probably damaging 1.00
R7228:Trim2 UTSW 3 84192181 missense probably benign 0.01
R7297:Trim2 UTSW 3 84210233 missense probably damaging 1.00
X0065:Trim2 UTSW 3 84165173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGAATCTCTGAGGTATCCAAAGCC -3'
(R):5'- CGTTGTCAGCACATCACTGATG -3'

Sequencing Primer
(F):5'- TGAGGTATCCAAAGCCCTCCC -3'
(R):5'- GTTGTCAGCACATCACTGATGAGAAC -3'
Posted On2014-08-25