Incidental Mutation 'R2046:Pygo2'
ID221934
Institutional Source Beutler Lab
Gene Symbol Pygo2
Ensembl Gene ENSMUSG00000047824
Gene Namepygopus 2
Synonyms1190004M21Rik, mpygo2
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2046 (G1)
Quality Score129
Status Validated
Chromosome3
Chromosomal Location89430214-89435128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89433148 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 284 (N284K)
Ref Sequence ENSEMBL: ENSMUSP00000053672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000039110] [ENSMUST00000060061] [ENSMUST00000094378] [ENSMUST00000107413] [ENSMUST00000107417] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630] [ENSMUST00000191485]
Predicted Effect probably benign
Transcript: ENSMUST00000038942
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039110
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060061
AA Change: N284K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053672
Gene: ENSMUSG00000047824
AA Change: N284K

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Blast:SH2 52 78 1e-9 BLAST
low complexity region 115 163 N/A INTRINSIC
low complexity region 177 193 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
PHD 328 382 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094378
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107413
AA Change: N247K
SMART Domains Protein: ENSMUSP00000103036
Gene: ENSMUSG00000047824
AA Change: N247K

DomainStartEndE-ValueType
Blast:SH2 15 41 1e-9 BLAST
low complexity region 78 126 N/A INTRINSIC
low complexity region 140 156 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
low complexity region 272 287 N/A INTRINSIC
PHD 291 345 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107417
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125830
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141340
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146037
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Predicted Effect probably benign
Transcript: ENSMUST00000191485
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, have small or absent lens, abnormal optic cup morphology, and impaired mammary gland epithelium proliferation. Mice homozygous for a knock-in allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in Pygo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Pygo2 APN 3 89432446 unclassified probably benign
R0147:Pygo2 UTSW 3 89433303 missense probably damaging 1.00
R0330:Pygo2 UTSW 3 89433154 missense possibly damaging 0.72
R4093:Pygo2 UTSW 3 89433264 missense probably damaging 0.98
R5341:Pygo2 UTSW 3 89432760 missense probably damaging 0.98
R7172:Pygo2 UTSW 3 89432636 missense probably benign 0.23
R7386:Pygo2 UTSW 3 89432821 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AACCAGGAGCACCTTTTGG -3'
(R):5'- AAACCACTTCTGGCAGGAGG -3'

Sequencing Primer
(F):5'- CCTTTTGGTCCTTCTCTTCAGAGAC -3'
(R):5'- ACAGAATGGCATCCTGGTC -3'
Posted On2014-08-25