Incidental Mutation 'R1978:Plcg1'
ID221952
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Namephospholipase C, gamma 1
SynonymsCded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160731300-160775760 bp(+) (GRCm38)
Type of Mutationunclassified (4690 bp from exon)
DNA Base Change (assembly) A to G at 160752578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590] [ENSMUST00000174885]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect probably null
Transcript: ENSMUST00000103115
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109462
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147254
Predicted Effect probably benign
Transcript: ENSMUST00000151590
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Predicted Effect probably null
Transcript: ENSMUST00000174885
SMART Domains Protein: ENSMUSP00000134720
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
SCOP:d1mai__ 27 110 2e-16 SMART
Blast:PH 28 110 6e-53 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 intron probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160752366 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160748088 missense probably benign 0.00
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 intron probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5647:Plcg1 UTSW 2 160751668 missense probably benign 0.45
R5929:Plcg1 UTSW 2 160753602 intron probably null
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCTGCATTGAGTGTACG -3'
(R):5'- AGACCACAGCTACAGGCATG -3'

Sequencing Primer
(F):5'- CATTGAGTGTACGTTGGGTCTAAG -3'
(R):5'- CCACAGCTACAGGCATGTTTTTGAG -3'
Posted On2014-08-25