Incidental Mutation 'R2046:Clec4n'
ID221953
Institutional Source Beutler Lab
Gene Symbol Clec4n
Ensembl Gene ENSMUSG00000023349
Gene NameC-type lectin domain family 4, member n
Synonymsdectin-2, Clecsf10, Nkcl
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123229843-123247021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123246504 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 153 (N153K)
Ref Sequence ENSEMBL: ENSMUSP00000113733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024118] [ENSMUST00000112554] [ENSMUST00000117130] [ENSMUST00000151714] [ENSMUST00000205129]
Predicted Effect probably benign
Transcript: ENSMUST00000024118
AA Change: N183K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024118
Gene: ENSMUSG00000023349
AA Change: N183K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 203 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112554
AA Change: N149K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108173
Gene: ENSMUSG00000023349
AA Change: N149K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 169 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117130
AA Change: N153K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113733
Gene: ENSMUSG00000023349
AA Change: N153K

DomainStartEndE-ValueType
CLECT 49 173 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151714
SMART Domains Protein: ENSMUSP00000120043
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205129
SMART Domains Protein: ENSMUSP00000145023
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
Blast:CLECT 26 72 3e-13 BLAST
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele have defective responses to Candida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in Clec4n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Clec4n APN 6 123244474 intron probably benign
IGL02248:Clec4n APN 6 123230568 missense probably damaging 0.99
IGL03181:Clec4n APN 6 123230515 missense possibly damaging 0.90
IGL03293:Clec4n APN 6 123232146 missense probably benign 0.10
P4717OSA:Clec4n UTSW 6 123244540 missense probably damaging 0.97
P4748:Clec4n UTSW 6 123244540 missense probably damaging 0.97
R1137:Clec4n UTSW 6 123246567 missense possibly damaging 0.80
R1445:Clec4n UTSW 6 123235516 missense probably benign 0.01
R1538:Clec4n UTSW 6 123230033 missense possibly damaging 0.66
R1804:Clec4n UTSW 6 123230022 missense possibly damaging 0.46
R1960:Clec4n UTSW 6 123230546 missense probably damaging 0.99
R4097:Clec4n UTSW 6 123230741 missense possibly damaging 0.66
R4657:Clec4n UTSW 6 123232196 critical splice donor site probably null
R4967:Clec4n UTSW 6 123232107 missense probably benign 0.41
R5471:Clec4n UTSW 6 123232186 missense probably benign 0.06
R6703:Clec4n UTSW 6 123235594 missense probably null 1.00
R7411:Clec4n UTSW 6 123232186 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAAAACTGCCCATATTTGGC -3'
(R):5'- AGAACGGCCTCTGTCAGATG -3'

Sequencing Primer
(F):5'- GAGAAAATGCTGGAATGTTCTCTC -3'
(R):5'- CTCTGTCAGATGTACAGGCCAAG -3'
Posted On2014-08-25