Incidental Mutation 'R1978:Cfap57'
ID221972
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118593132 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 598 (S598P)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: S598P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: S598P

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: S598P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: S598P

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TATGACTAGCCAGCAGGTGC -3'
(R):5'- TTCACATGCGGCTACTATACC -3'

Sequencing Primer
(F):5'- GCAACACAGAAACTGCTGG -3'
(R):5'- GCGGCTACTATACCAAATACTATAAG -3'
Posted On2014-08-25