Incidental Mutation 'R1978:2810474O19Rik'
ID222002
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 039991-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149326432 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 325 (N325K)
Ref Sequence ENSEMBL: ENSMUSP00000115573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably benign
Transcript: ENSMUST00000046689
AA Change: N325K

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: N325K

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100765
AA Change: N325K

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: N325K

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably damaging
Transcript: ENSMUST00000130664
AA Change: N325K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably benign
Transcript: ENSMUST00000189837
AA Change: N325K

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: N325K

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189932
AA Change: N325K

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: N325K

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
AA Change: N325K

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: N325K

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAAAGACTCTCTGCCCTTC -3'
(R):5'- GTTTTACTACAACCAGCTGCC -3'

Sequencing Primer
(F):5'- CCTTACAGCTGTAGATATGAAAACC -3'
(R):5'- TAGAGATTTAATATCCCTCACCAGC -3'
Posted On2014-08-25