Incidental Mutation 'R2046:March6'
ID222019
Institutional Source Beutler Lab
Gene Symbol March6
Ensembl Gene ENSMUSG00000039100
Gene Namemembrane-associated ring finger (C3HC4) 6
SynonymsF830029L24Rik
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location31455891-31531053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31486434 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 325 (V325A)
Ref Sequence ENSEMBL: ENSMUSP00000087694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090227]
Predicted Effect probably benign
Transcript: ENSMUST00000090227
AA Change: V325A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087694
Gene: ENSMUSG00000039100
AA Change: V325A

DomainStartEndE-ValueType
RINGv 8 56 1.13e-21 SMART
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 223 259 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 522 540 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
transmembrane domain 805 827 N/A INTRINSIC
transmembrane domain 847 866 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227757
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated E3 ubiquitin ligases containing RING-CH-type zinc finger motifs. Ubiquitination of type II deiodinase by the encoded protein is an important regulatory step in thyroid hormone signalling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in March6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:March6 APN 15 31475763 missense probably benign 0.00
IGL00902:March6 APN 15 31484978 missense probably damaging 1.00
IGL02352:March6 APN 15 31509759 missense probably damaging 1.00
IGL02359:March6 APN 15 31509759 missense probably damaging 1.00
IGL02565:March6 APN 15 31490566 splice site probably benign
IGL02735:March6 APN 15 31486120 missense probably benign 0.00
IGL02808:March6 APN 15 31478406 missense probably benign 0.32
IGL03122:March6 APN 15 31478293 critical splice donor site probably null
IGL03235:March6 APN 15 31485995 missense probably damaging 1.00
IGL03238:March6 APN 15 31461941 critical splice donor site probably benign
IGL03263:March6 APN 15 31486362 missense probably benign 0.01
R0003:March6 UTSW 15 31469532 splice site probably benign
R0056:March6 UTSW 15 31467734 missense possibly damaging 0.68
R0115:March6 UTSW 15 31475812 missense probably benign
R0126:March6 UTSW 15 31462005 missense probably benign 0.00
R0148:March6 UTSW 15 31490612 missense probably damaging 0.99
R0744:March6 UTSW 15 31480291 missense probably benign 0.00
R0833:March6 UTSW 15 31480291 missense probably benign 0.00
R1205:March6 UTSW 15 31469673 missense probably benign 0.01
R1339:March6 UTSW 15 31486402 missense probably benign 0.12
R1485:March6 UTSW 15 31498693 missense probably damaging 0.96
R1885:March6 UTSW 15 31502806 missense probably benign 0.00
R1889:March6 UTSW 15 31459193 missense possibly damaging 0.86
R1984:March6 UTSW 15 31469646 missense probably damaging 0.99
R2007:March6 UTSW 15 31461941 critical splice donor site probably null
R2135:March6 UTSW 15 31509764 nonsense probably null
R3116:March6 UTSW 15 31486119 missense probably benign 0.00
R3710:March6 UTSW 15 31509826 splice site probably benign
R3715:March6 UTSW 15 31465259 missense probably benign 0.00
R3749:March6 UTSW 15 31462014 missense probably benign 0.00
R3944:March6 UTSW 15 31488814 missense probably benign 0.00
R4327:March6 UTSW 15 31498741 missense probably benign 0.17
R4329:March6 UTSW 15 31498741 missense probably benign 0.17
R5001:March6 UTSW 15 31465322 missense probably damaging 0.98
R5149:March6 UTSW 15 31461994 missense possibly damaging 0.53
R5654:March6 UTSW 15 31485936 missense probably damaging 1.00
R6163:March6 UTSW 15 31465351 missense probably benign
R6172:March6 UTSW 15 31482867 missense possibly damaging 0.86
R6381:March6 UTSW 15 31467692 missense probably benign 0.01
R6888:March6 UTSW 15 31459233 missense probably benign 0.00
R7347:March6 UTSW 15 31486359 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCAACTTTTATGAAGACACAGG -3'
(R):5'- AGCAGTCTGTATATGAGTGAGTC -3'

Sequencing Primer
(F):5'- CTTTTATGAAGACACAGGGGAAAAC -3'
(R):5'- CTGAGTTCAAAGCCAGCTTG -3'
Posted On2014-08-25