Incidental Mutation 'R1978:Myo6'
ID222022
Institutional Source Beutler Lab
Gene Symbol Myo6
Ensembl Gene ENSMUSG00000033577
Gene Namemyosin VI
SynonymsTlc
MMRRC Submission 039991-MU
Accession Numbers

MGI:104785

Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location80165031-80311729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80228925 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 110 (D110V)
Ref Sequence ENSEMBL: ENSMUSP00000108891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000113266] [ENSMUST00000113268] [ENSMUST00000127779] [ENSMUST00000184480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035889
AA Change: D110V

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577
AA Change: D110V

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000076140
AA Change: D110V

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577
AA Change: D110V

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000113266
AA Change: D110V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577
AA Change: D110V

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000113268
AA Change: D110V
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577
AA Change: D110V

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127779
AA Change: D110V
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577
AA Change: D110V

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000184480
AA Change: D110V
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577
AA Change: D110V

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Myo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
r5101_myo6 UTSW 9 80270039 nonsense probably null
torticollis UTSW 9 80288217 critical splice donor site probably null
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0791:Myo6 UTSW 9 80262374 splice site probably benign
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2092:Myo6 UTSW 9 80245682 missense probably damaging 1.00
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 intron probably null
R2898:Myo6 UTSW 9 80269611 intron probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5200:Myo6 UTSW 9 80276374 nonsense probably null
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R6693:Myo6 UTSW 9 80245731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTACGAGAATCAAAGGGC -3'
(R):5'- ATGAACAGAACCCACTTGCATG -3'

Sequencing Primer
(F):5'- TTGTACGAGAATCAAAGGGCTCTGTC -3'
(R):5'- CCACTTGCATGAAAGCATCCTTATG -3'
Posted On2014-08-25