Incidental Mutation 'R1978:Pno1'
ID222044
Institutional Source Beutler Lab
Gene Symbol Pno1
Ensembl Gene ENSMUSG00000020116
Gene Namepartner of NOB1 homolog
SynonymsImi3, 1810003N24Rik, expressed during mesenchymal induction 3, Emi3
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location17203198-17211568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17204519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 221 (I221V)
Ref Sequence ENSEMBL: ENSMUSP00000020317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020317] [ENSMUST00000102880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020317
AA Change: I221V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020317
Gene: ENSMUSG00000020116
AA Change: I221V

DomainStartEndE-ValueType
KH 153 226 8.92e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102880
SMART Domains Protein: ENSMUSP00000099944
Gene: ENSMUSG00000033953

DomainStartEndE-ValueType
EFh 22 50 2.95e0 SMART
EFh 54 82 1.14e-5 SMART
EFh 91 119 2.96e-4 SMART
EFh 132 160 3.01e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit eombryonic lethality between E3.5 and E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Pno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Pno1 APN 11 17211317 missense probably benign 0.00
IGL01475:Pno1 APN 11 17210992 missense probably damaging 1.00
IGL03166:Pno1 APN 11 17204513 unclassified probably null
R0184:Pno1 UTSW 11 17211127 missense probably benign 0.00
R1302:Pno1 UTSW 11 17204545 missense probably benign 0.42
R4345:Pno1 UTSW 11 17209095 missense possibly damaging 0.73
R4586:Pno1 UTSW 11 17211438 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTGTACTTGCTTAGGAATGC -3'
(R):5'- GTTTAGAACACTCTCCACCATTACC -3'

Sequencing Primer
(F):5'- TTTCACTCCTCTAACAAATGGAATCC -3'
(R):5'- ATTACCCTCACCTGCAGCTCAG -3'
Posted On2014-08-25