Incidental Mutation 'R1978:Porcn'
ID222091
Institutional Source Beutler Lab
Gene Symbol Porcn
Ensembl Gene ENSMUSG00000031169
Gene Nameporcupine O-acyltransferase
SynonymsMporc, DXHXS7465e, porc, 2410004O13Rik, mMg61
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1978 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location8193848-8206525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8204301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000086825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077595] [ENSMUST00000082320] [ENSMUST00000089402] [ENSMUST00000089403] [ENSMUST00000122943] [ENSMUST00000154695]
Predicted Effect probably damaging
Transcript: ENSMUST00000077595
AA Change: V75A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076790
Gene: ENSMUSG00000031169
AA Change: V75A

DomainStartEndE-ValueType
transmembrane domain 29 47 N/A INTRINSIC
Pfam:MBOAT 59 372 2.5e-22 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082320
AA Change: V75A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080937
Gene: ENSMUSG00000031169
AA Change: V75A

DomainStartEndE-ValueType
transmembrane domain 29 47 N/A INTRINSIC
Pfam:MBOAT 61 397 3.9e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089402
AA Change: V75A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086824
Gene: ENSMUSG00000031169
AA Change: V75A

DomainStartEndE-ValueType
transmembrane domain 29 47 N/A INTRINSIC
Pfam:MBOAT 61 391 4.5e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089403
AA Change: V75A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086825
Gene: ENSMUSG00000031169
AA Change: V75A

DomainStartEndE-ValueType
transmembrane domain 29 47 N/A INTRINSIC
Pfam:MBOAT 61 396 1.8e-41 PFAM
Predicted Effect silent
Transcript: ENSMUST00000122943
SMART Domains Protein: ENSMUSP00000138626
Gene: ENSMUSG00000031169

DomainStartEndE-ValueType
low complexity region 56 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139744
Predicted Effect probably benign
Transcript: ENSMUST00000154695
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the evolutionarily conserved porcupine (Porc) gene family. Genes of the porcupine family encode endoplasmic reticulum proteins with multiple transmembrane domains. Porcupine proteins are involved in the processing of Wnt (wingless and int homologue) proteins. Disruption of this gene is associated with focal dermal hypoplasia, and the encoded protein has been implicated in cancer. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in the epiblast exhibit abnormal mesoderm development, dermal atrophy, sternum hypoplasia, cleft palate, tail hypoplasia, absence of the autopod, abnormal hair follicle development, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Porcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Porcn APN X 8201662 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTCATCAAGGCCTTGGG -3'
(R):5'- AGCTTTGGGTCCCCTTAGAC -3'

Sequencing Primer
(F):5'- CCCCATGAGCAGGTAGAT -3'
(R):5'- TAGACCCCAGCATGTTCTAGG -3'
Posted On2014-08-25