Incidental Mutation 'R2048:Hal'
ID222251
Institutional Source Beutler Lab
Gene Symbol Hal
Ensembl Gene ENSMUSG00000020017
Gene Namehistidine ammonia lyase
Synonymshistidase, Hsd
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93488768-93519304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93491140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 176 (T176A)
Ref Sequence ENSEMBL: ENSMUSP00000123336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016031] [ENSMUST00000129421]
Predicted Effect probably benign
Transcript: ENSMUST00000016031
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129421
AA Change: T176A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017
AA Change: T176A

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of the histidase protein family. The encoded protein is a cytosolic enzyme which catalyzes the first reaction in histidine catabolism. Defects in this protein cause histidinemia, which is characterized by increased histidine in blood, urine, and cerebrospinal fluid. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this gene cause elevated histidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Ceacam1 G T 7: 25,476,688 S27Y probably benign Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Hal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hal APN 10 93490069 critical splice donor site probably null
IGL01528:Hal APN 10 93497593 missense probably damaging 1.00
IGL01818:Hal APN 10 93490984 missense probably damaging 0.99
IGL01903:Hal APN 10 93500607 splice site probably benign
IGL02152:Hal APN 10 93503542 missense possibly damaging 0.74
IGL02249:Hal APN 10 93497538 missense probably damaging 0.99
IGL02366:Hal APN 10 93503528 missense probably damaging 1.00
IGL02421:Hal APN 10 93503473 missense probably damaging 0.98
IGL02721:Hal APN 10 93507498 nonsense probably null
2k1 UTSW 10 93514143 critical splice donor site probably null
alger UTSW 10 93507551 critical splice donor site probably null
Whittaker UTSW 10 93516284 missense probably benign
R0048:Hal UTSW 10 93498991 missense probably damaging 1.00
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0372:Hal UTSW 10 93507553 splice site probably benign
R0465:Hal UTSW 10 93516284 missense probably benign
R0504:Hal UTSW 10 93489174 missense probably damaging 0.99
R1357:Hal UTSW 10 93500623 missense probably damaging 0.96
R1623:Hal UTSW 10 93516297 missense probably benign 0.00
R1757:Hal UTSW 10 93494628 missense probably benign 0.14
R1918:Hal UTSW 10 93496607 missense probably damaging 1.00
R2291:Hal UTSW 10 93503536 missense probably damaging 0.98
R3001:Hal UTSW 10 93507519 missense probably damaging 1.00
R3002:Hal UTSW 10 93507519 missense probably damaging 1.00
R3927:Hal UTSW 10 93514026 splice site probably benign
R3948:Hal UTSW 10 93489907 missense possibly damaging 0.94
R4394:Hal UTSW 10 93496559 intron probably benign
R4623:Hal UTSW 10 93507439 missense probably damaging 1.00
R4922:Hal UTSW 10 93503539 missense probably damaging 1.00
R5018:Hal UTSW 10 93507551 critical splice donor site probably null
R5072:Hal UTSW 10 93514042 missense probably damaging 0.99
R5073:Hal UTSW 10 93514042 missense probably damaging 0.99
R5074:Hal UTSW 10 93514042 missense probably damaging 0.99
R5303:Hal UTSW 10 93516365 utr 3 prime probably benign
R5806:Hal UTSW 10 93490984 missense probably damaging 0.97
R5992:Hal UTSW 10 93490916 missense probably damaging 1.00
R6294:Hal UTSW 10 93514143 critical splice donor site probably null
R6370:Hal UTSW 10 93497506 missense probably damaging 1.00
R6747:Hal UTSW 10 93500677 missense probably damaging 1.00
R7142:Hal UTSW 10 93500651 missense possibly damaging 0.85
R7299:Hal UTSW 10 93492561 missense probably benign 0.00
R7301:Hal UTSW 10 93492561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCATCGACAGCATCATCAAAG -3'
(R):5'- TGAGAATTTGCTGCCCATGG -3'

Sequencing Primer
(F):5'- GAAAGAACAGGTATCCTTTTCTCTC -3'
(R):5'- TGGGGCTCACATATCAGGATATCC -3'
Posted On2014-08-25