Incidental Mutation 'R1981:Mast2'
ID222274
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Namemicrotubule associated serine/threonine kinase 2
SynonymsMAST205, Mtssk
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116306762-116464183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116314840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 569 (Y569C)
Ref Sequence ENSEMBL: ENSMUSP00000003908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486]
Predicted Effect probably damaging
Transcript: ENSMUST00000003908
AA Change: Y569C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810
AA Change: Y569C

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106484
AA Change: Y576C

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810
AA Change: Y576C

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106485
AA Change: Y630C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810
AA Change: Y630C

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106486
AA Change: Y637C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810
AA Change: Y637C

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156884
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116311329 missense probably benign 0.39
IGL00916:Mast2 APN 4 116327633 missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116319764 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116307987 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116312846 splice site probably benign
R0883:Mast2 UTSW 4 116311767 missense probably damaging 1.00
R1447:Mast2 UTSW 4 116312013 missense probably benign 0.02
R1449:Mast2 UTSW 4 116309013 missense probably damaging 1.00
R1473:Mast2 UTSW 4 116311955 missense probably damaging 1.00
R1491:Mast2 UTSW 4 116316491 missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116430519 missense probably benign 0.17
R1654:Mast2 UTSW 4 116316550 critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116306959 missense probably damaging 1.00
R1807:Mast2 UTSW 4 116310741 splice site probably benign
R2081:Mast2 UTSW 4 116330474 splice site probably null
R2157:Mast2 UTSW 4 116322283 missense probably damaging 1.00
R3409:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3435:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3953:Mast2 UTSW 4 116313729 missense probably damaging 1.00
R4056:Mast2 UTSW 4 116337501 splice site probably benign
R4153:Mast2 UTSW 4 116315963 missense possibly damaging 0.91
R4648:Mast2 UTSW 4 116314839 nonsense probably null
R4671:Mast2 UTSW 4 116308650 missense probably damaging 1.00
R4911:Mast2 UTSW 4 116353057 missense probably benign 0.36
R4980:Mast2 UTSW 4 116317751 missense probably damaging 1.00
R5322:Mast2 UTSW 4 116333411 critical splice donor site probably null
R5462:Mast2 UTSW 4 116307458 missense probably damaging 0.99
R5586:Mast2 UTSW 4 116435563 missense probably damaging 0.99
R5750:Mast2 UTSW 4 116308889 intron probably benign
R5771:Mast2 UTSW 4 116333425 missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116314838 missense probably damaging 1.00
R6230:Mast2 UTSW 4 116326098 missense probably damaging 1.00
R6347:Mast2 UTSW 4 116317732 missense probably damaging 1.00
R6527:Mast2 UTSW 4 116314939 missense probably damaging 0.99
R6619:Mast2 UTSW 4 116316497 nonsense probably null
R7070:Mast2 UTSW 4 116310855 missense probably benign 0.03
R7303:Mast2 UTSW 4 116308311 missense possibly damaging 0.63
X0003:Mast2 UTSW 4 116307647 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCATGAGTGGCATCTGAC -3'
(R):5'- CCTAAGAACTGACTGGAGCAGG -3'

Sequencing Primer
(F):5'- CAGAGGTCTGTGTTTCAAAGC -3'
(R):5'- CAGGGTCCTGGATCATGATAGC -3'
Posted On2014-08-25