Incidental Mutation 'R1981:Git2'
ID222284
Institutional Source Beutler Lab
Gene Symbol Git2
Ensembl Gene ENSMUSG00000041890
Gene NameG protein-coupled receptor kinase-interactor 2
Synonyms5830420E16Rik, Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 9630056M03Rik, B230104M05Rik, 1500036H07Rik, Cat-2
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R1981 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location114727407-114775517 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 114749559 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043283] [ENSMUST00000086564] [ENSMUST00000112183] [ENSMUST00000112185] [ENSMUST00000131993] [ENSMUST00000155908] [ENSMUST00000178440]
Predicted Effect probably benign
Transcript: ENSMUST00000043283
SMART Domains Protein: ENSMUSP00000039718
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT1_C 550 674 2.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086564
SMART Domains Protein: ENSMUSP00000083754
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT_CC 414 478 3.7e-31 PFAM
low complexity region 555 570 N/A INTRINSIC
Pfam:GIT1_C 636 752 6.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112183
SMART Domains Protein: ENSMUSP00000107801
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 268 298 4.96e-10 SMART
GIT 332 362 1.27e-7 SMART
Pfam:GIT1_C 552 676 1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112185
SMART Domains Protein: ENSMUSP00000107803
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 265 295 4.96e-10 SMART
GIT 329 359 1.27e-7 SMART
low complexity region 504 519 N/A INTRINSIC
Pfam:GIT1_C 579 703 3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130925
SMART Domains Protein: ENSMUSP00000115185
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
Pfam:GIT_SHD 1 21 9.7e-5 PFAM
Pfam:GIT_CC 77 115 7.7e-14 PFAM
low complexity region 203 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131993
SMART Domains Protein: ENSMUSP00000118812
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ANK 21 50 2.55e2 SMART
ANK 55 84 1.21e1 SMART
ANK 88 117 3.95e1 SMART
Pfam:GIT_SHD 156 186 7.9e-19 PFAM
Pfam:GIT_SHD 220 249 3.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153756
Predicted Effect probably benign
Transcript: ENSMUST00000155908
SMART Domains Protein: ENSMUSP00000122302
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ArfGap 1 96 2.04e-25 SMART
ANK 104 133 2.55e2 SMART
ANK 138 167 1.21e1 SMART
ANK 171 200 3.95e1 SMART
GIT 238 268 4.96e-10 SMART
GIT 302 332 1.27e-7 SMART
Pfam:GIT1_C 474 598 8.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178440
SMART Domains Protein: ENSMUSP00000136796
Gene: ENSMUSG00000041890

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 267 297 4.96e-10 SMART
GIT 331 361 1.27e-7 SMART
Pfam:GIT1_C 551 675 2.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202581
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele show frequent splenomegaly, extramedullary hematopoiesis, impaired neutrophil chemotaxis, misoriented hyperproduction of superoxide anions and increased susceptibility to fungal infection. Homozygotes for a gene trap allele have reduced marginal zone B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Git2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Git2 APN 5 114767105 missense probably damaging 1.00
IGL02538:Git2 APN 5 114730986 splice site probably benign
IGL03114:Git2 APN 5 114733857 splice site probably benign
IGL03278:Git2 APN 5 114745579 splice site probably benign
IGL03278:Git2 APN 5 114745580 splice site probably null
R0184:Git2 UTSW 5 114739037 missense possibly damaging 0.47
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0540:Git2 UTSW 5 114748274 missense probably damaging 1.00
R0543:Git2 UTSW 5 114745531 missense probably damaging 0.97
R0612:Git2 UTSW 5 114752281 missense probably damaging 1.00
R1144:Git2 UTSW 5 114753314 missense probably benign 0.27
R1225:Git2 UTSW 5 114733178 splice site probably benign
R1783:Git2 UTSW 5 114739124 missense probably damaging 1.00
R1923:Git2 UTSW 5 114739101 missense probably damaging 1.00
R1956:Git2 UTSW 5 114749337 nonsense probably null
R2029:Git2 UTSW 5 114766450 critical splice donor site probably null
R3150:Git2 UTSW 5 114730349 missense probably damaging 1.00
R4087:Git2 UTSW 5 114764405 missense probably damaging 0.99
R4367:Git2 UTSW 5 114764666 missense probably damaging 1.00
R4400:Git2 UTSW 5 114733909 missense possibly damaging 0.94
R4702:Git2 UTSW 5 114745482 missense probably damaging 1.00
R4758:Git2 UTSW 5 114730351 missense probably damaging 1.00
R4840:Git2 UTSW 5 114745482 missense probably damaging 1.00
R5236:Git2 UTSW 5 114767172 missense probably damaging 1.00
R5427:Git2 UTSW 5 114730328 missense possibly damaging 0.82
R5510:Git2 UTSW 5 114743774 critical splice donor site probably null
R6014:Git2 UTSW 5 114733877 missense probably benign 0.32
R6162:Git2 UTSW 5 114761656 missense probably damaging 0.99
R6195:Git2 UTSW 5 114767114 missense probably benign 0.27
R6198:Git2 UTSW 5 114745495 nonsense probably null
R6233:Git2 UTSW 5 114767114 missense probably benign 0.27
R6277:Git2 UTSW 5 114733247 missense probably damaging 1.00
R6603:Git2 UTSW 5 114730991 critical splice donor site probably null
R7141:Git2 UTSW 5 114769698 nonsense probably null
R7420:Git2 UTSW 5 114730370 missense probably benign 0.00
R7468:Git2 UTSW 5 114733897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTACTGTGGTTCTGCG -3'
(R):5'- GGCTTTGAGTAGGAACACCC -3'

Sequencing Primer
(F):5'- GGTTCTGCGTGGCAAGC -3'
(R):5'- TTTGAGTAGGAACACCCCCACC -3'
Posted On2014-08-25