Incidental Mutation 'R2013:Mob3b'
ID222320
Institutional Source Beutler Lab
Gene Symbol Mob3b
Ensembl Gene ENSMUSG00000073910
Gene NameMOB kinase activator 3B
SynonymsA430018A01Rik, MOB3B, 8430436F23Rik, Mobkl2b
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34949074-35157484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35083922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 89 (V89A)
Ref Sequence ENSEMBL: ENSMUSP00000100040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102975]
Predicted Effect probably benign
Transcript: ENSMUST00000102975
AA Change: V89A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100040
Gene: ENSMUSG00000073910
AA Change: V89A

DomainStartEndE-ValueType
Mob1_phocein 33 207 1.93e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155725
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. This gene is located on the opposite strand as the interferon kappa precursor (IFNK) gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Mob3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Mob3b APN 4 35083983 missense probably damaging 1.00
IGL02991:Mob3b UTSW 4 35083805 missense probably benign 0.01
R0016:Mob3b UTSW 4 35083947 missense probably benign 0.02
R0408:Mob3b UTSW 4 35083991 missense probably damaging 1.00
R1542:Mob3b UTSW 4 35084046 missense possibly damaging 0.88
R1686:Mob3b UTSW 4 34985910 splice site probably benign
R1723:Mob3b UTSW 4 34954026 missense probably damaging 0.99
R1726:Mob3b UTSW 4 34954028 missense probably benign 0.09
R2112:Mob3b UTSW 4 35083795 missense probably damaging 0.97
R5992:Mob3b UTSW 4 35084069 missense probably benign 0.43
R6043:Mob3b UTSW 4 34985993 missense probably benign 0.05
R6418:Mob3b UTSW 4 34954049 critical splice acceptor site probably null
R7117:Mob3b UTSW 4 34985914 critical splice donor site probably null
R7170:Mob3b UTSW 4 35083839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATCTCTAAGGCCATCGGG -3'
(R):5'- GCCCAAGAGGAAGTTTGAACC -3'

Sequencing Primer
(F):5'- TCGGGCACTTACCAACACATG -3'
(R):5'- TTTGAGCTGCACAAACGGGC -3'
Posted On2014-08-25