Incidental Mutation 'R2013:Macf1'
ID222324
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Namemicrotubule-actin crosslinking factor 1
Synonymstrabeculin alpha, Acf7, Aclp7
MMRRC Submission 040022-MU
Accession Numbers

Ncbi RefSeq: NM_001199136.1, NM_001199137.1; MGI:108559

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123349633-123684360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123684014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 59 (D59G)
Ref Sequence ENSEMBL: ENSMUSP00000101831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106224]
Predicted Effect probably damaging
Transcript: ENSMUST00000082108
AA Change: D59G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649
AA Change: D59G

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084301
AA Change: D59G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: D59G

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097897
AA Change: D59G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: D59G

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106224
AA Change: D59G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: D59G

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype Strain: 3652899; 4831019
Lethality: E7-E8
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123382122 missense probably damaging 0.99
IGL01293:Macf1 APN 4 123471311 missense probably benign 0.00
IGL01307:Macf1 APN 4 123383129 missense probably damaging 1.00
IGL01314:Macf1 APN 4 123486720 missense probably damaging 1.00
IGL01321:Macf1 APN 4 123440774 missense probably damaging 1.00
IGL01327:Macf1 APN 4 123509912 missense probably benign 0.20
IGL01365:Macf1 APN 4 123391169 missense probably damaging 1.00
IGL01465:Macf1 APN 4 123490721 missense probably benign 0.00
IGL01527:Macf1 APN 4 123493160 missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123473873 missense probably damaging 1.00
IGL01539:Macf1 APN 4 123395908 splice site probably benign
IGL01543:Macf1 APN 4 123401457 missense probably damaging 1.00
IGL01553:Macf1 APN 4 123493163 nonsense probably null
IGL01558:Macf1 APN 4 123453005 missense probably benign 0.00
IGL01633:Macf1 APN 4 123502171 missense probably damaging 0.99
IGL01684:Macf1 APN 4 123465930 missense probably damaging 1.00
IGL01715:Macf1 APN 4 123391086 missense probably damaging 1.00
IGL01844:Macf1 APN 4 123440692 missense probably benign 0.34
IGL01870:Macf1 APN 4 123474113 missense probably damaging 0.99
IGL01916:Macf1 APN 4 123441630 missense probably damaging 1.00
IGL01916:Macf1 APN 4 123476037 missense probably damaging 1.00
IGL01923:Macf1 APN 4 123380444 missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123499931 missense probably damaging 1.00
IGL02022:Macf1 APN 4 123391049 critical splice donor site probably null
IGL02084:Macf1 APN 4 123432603 missense probably benign 0.02
IGL02084:Macf1 APN 4 123459374 missense probably damaging 1.00
IGL02142:Macf1 APN 4 123472049 missense probably benign 0.11
IGL02151:Macf1 APN 4 123371766 splice site probably benign
IGL02164:Macf1 APN 4 123480272 missense probably benign 0.03
IGL02174:Macf1 APN 4 123491794 missense probably damaging 1.00
IGL02229:Macf1 APN 4 123509826 missense probably damaging 1.00
IGL02277:Macf1 APN 4 123486704 missense probably damaging 1.00
IGL02283:Macf1 APN 4 123471375 missense probably benign 0.01
IGL02314:Macf1 APN 4 123444837 missense probably damaging 0.99
IGL02327:Macf1 APN 4 123471730 missense probably benign 0.06
IGL02348:Macf1 APN 4 123512866 missense probably damaging 1.00
IGL02441:Macf1 APN 4 123387236 missense probably damaging 1.00
IGL02585:Macf1 APN 4 123472284 missense probably benign 0.00
IGL02602:Macf1 APN 4 123355163 missense probably damaging 1.00
IGL03204:Macf1 APN 4 123355277 splice site probably benign
Royal_flush UTSW 4 123365355 splice site probably null
suspension UTSW 4 123497755 missense probably damaging 1.00
voragine UTSW 4 123355102 missense probably damaging 1.00
H8562:Macf1 UTSW 4 123466040 missense probably benign 0.13
IGL03052:Macf1 UTSW 4 123387395 missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123473321 missense probably benign 0.43
R0021:Macf1 UTSW 4 123475577 missense probably damaging 1.00
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0028:Macf1 UTSW 4 123382102 missense probably damaging 1.00
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123473868 missense probably damaging 1.00
R0106:Macf1 UTSW 4 123408564 missense probably benign 0.00
R0123:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0129:Macf1 UTSW 4 123433275 missense probably damaging 1.00
R0134:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123440747 missense probably damaging 1.00
R0145:Macf1 UTSW 4 123387397 missense probably damaging 1.00
R0195:Macf1 UTSW 4 123434916 missense probably damaging 0.99
R0227:Macf1 UTSW 4 123399391 missense probably benign 0.14
R0233:Macf1 UTSW 4 123450127 splice site probably benign
R0254:Macf1 UTSW 4 123432779 missense probably damaging 1.00
R0357:Macf1 UTSW 4 123457983 missense probably damaging 1.00
R0398:Macf1 UTSW 4 123351017 missense probably damaging 1.00
R0413:Macf1 UTSW 4 123472269 missense probably benign
R0426:Macf1 UTSW 4 123483660 nonsense probably null
R0441:Macf1 UTSW 4 123365355 splice site probably null
R0453:Macf1 UTSW 4 123444944 missense probably benign 0.35
R0481:Macf1 UTSW 4 123484022 splice site probably null
R0502:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0503:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0519:Macf1 UTSW 4 123471320 missense probably benign 0.03
R0543:Macf1 UTSW 4 123376378 missense probably damaging 1.00
R0621:Macf1 UTSW 4 123380534 missense probably damaging 1.00
R0631:Macf1 UTSW 4 123455524 nonsense probably null
R0720:Macf1 UTSW 4 123432925 missense probably damaging 1.00
R0730:Macf1 UTSW 4 123382530 splice site probably benign
R0755:Macf1 UTSW 4 123369926 missense probably damaging 0.99
R0836:Macf1 UTSW 4 123494882 critical splice donor site probably null
R0847:Macf1 UTSW 4 123399366 missense probably benign 0.03
R0850:Macf1 UTSW 4 123474402 missense probably benign
R0924:Macf1 UTSW 4 123385478 missense probably damaging 1.00
R0973:Macf1 UTSW 4 123476000 missense possibly damaging 0.76
R1025:Macf1 UTSW 4 123473816 missense probably damaging 1.00
R1076:Macf1 UTSW 4 123385598 missense probably damaging 1.00
R1253:Macf1 UTSW 4 123457967 missense probably damaging 1.00
R1301:Macf1 UTSW 4 123486658 splice site probably benign
R1337:Macf1 UTSW 4 123476275 missense probably benign 0.34
R1344:Macf1 UTSW 4 123433453 missense probably damaging 0.99
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1443:Macf1 UTSW 4 123511007 missense probably damaging 1.00
R1452:Macf1 UTSW 4 123493998 missense probably benign
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1483:Macf1 UTSW 4 123510977 missense probably damaging 1.00
R1509:Macf1 UTSW 4 123684009 missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123434762 missense probably null 1.00
R1515:Macf1 UTSW 4 123378480 missense probably damaging 1.00
R1524:Macf1 UTSW 4 123432530 missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123476014 missense probably benign 0.30
R1535:Macf1 UTSW 4 123440693 missense probably benign 0.05
R1556:Macf1 UTSW 4 123455020 missense probably damaging 1.00
R1564:Macf1 UTSW 4 123459357 missense probably benign 0.00
R1586:Macf1 UTSW 4 123509846 missense probably benign 0.20
R1626:Macf1 UTSW 4 123471534 missense probably benign
R1629:Macf1 UTSW 4 123508415 nonsense probably null
R1649:Macf1 UTSW 4 123484053 missense probably damaging 0.96
R1650:Macf1 UTSW 4 123456600 nonsense probably null
R1706:Macf1 UTSW 4 123370584 critical splice donor site probably null
R1713:Macf1 UTSW 4 123378694 missense probably damaging 1.00
R1716:Macf1 UTSW 4 123401403 missense probably damaging 1.00
R1744:Macf1 UTSW 4 123475853 missense probably damaging 1.00
R1752:Macf1 UTSW 4 123483672 missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123512108 missense probably damaging 1.00
R1812:Macf1 UTSW 4 123432024 missense probably damaging 1.00
R1818:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R1853:Macf1 UTSW 4 123512720 intron probably null
R1856:Macf1 UTSW 4 123369848 missense probably damaging 1.00
R1869:Macf1 UTSW 4 123351128 missense probably damaging 1.00
R1880:Macf1 UTSW 4 123438591 missense probably damaging 1.00
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1902:Macf1 UTSW 4 123471165 missense probably benign 0.01
R1907:Macf1 UTSW 4 123372399 missense probably damaging 1.00
R1908:Macf1 UTSW 4 123457841 missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123452037 missense probably damaging 1.00
R1944:Macf1 UTSW 4 123370666 missense probably damaging 1.00
R1945:Macf1 UTSW 4 123490660 nonsense probably null
R1975:Macf1 UTSW 4 123489212 missense probably damaging 1.00
R1989:Macf1 UTSW 4 123497726 critical splice donor site probably null
R1991:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R1992:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R2021:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2022:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2023:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2024:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2025:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2027:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2049:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2060:Macf1 UTSW 4 123499919 unclassified probably null
R2092:Macf1 UTSW 4 123383178 missense probably damaging 1.00
R2100:Macf1 UTSW 4 123397906 nonsense probably null
R2128:Macf1 UTSW 4 123492774 missense probably benign 0.11
R2129:Macf1 UTSW 4 123368815 splice site probably benign
R2140:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2142:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2182:Macf1 UTSW 4 123492671 missense probably damaging 0.98
R2185:Macf1 UTSW 4 123475556 missense probably damaging 0.99
R2190:Macf1 UTSW 4 123459212 missense probably benign 0.11
R2320:Macf1 UTSW 4 123439495 missense probably benign 0.02
R2382:Macf1 UTSW 4 123374832 missense probably damaging 1.00
R2429:Macf1 UTSW 4 123432584 missense probably damaging 0.99
R2432:Macf1 UTSW 4 123683996 missense probably damaging 1.00
R2484:Macf1 UTSW 4 123473672 missense probably damaging 1.00
R2842:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R2912:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2913:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2914:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2938:Macf1 UTSW 4 123432902 missense probably damaging 0.99
R3082:Macf1 UTSW 4 123361443 splice site probably null
R3086:Macf1 UTSW 4 123435108 missense probably benign 0.00
R3408:Macf1 UTSW 4 123381781 missense probably damaging 1.00
R3499:Macf1 UTSW 4 123527305 nonsense probably null
R3696:Macf1 UTSW 4 123456362 missense probably damaging 1.00
R3716:Macf1 UTSW 4 123473502 missense probably benign 0.01
R3727:Macf1 UTSW 4 123459311 missense probably damaging 1.00
R3770:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3813:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3825:Macf1 UTSW 4 123444951 missense probably benign 0.11
R3893:Macf1 UTSW 4 123486406 missense probably damaging 1.00
R3896:Macf1 UTSW 4 123471194 missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123380420 missense probably damaging 1.00
R4031:Macf1 UTSW 4 123381312 missense probably damaging 1.00
R4052:Macf1 UTSW 4 123472017 missense probably benign 0.00
R4077:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4078:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4084:Macf1 UTSW 4 123450072 missense probably damaging 0.98
R4094:Macf1 UTSW 4 123459269 missense probably benign 0.00
R4154:Macf1 UTSW 4 123471813 missense probably damaging 1.00
R4190:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123432392 missense probably damaging 1.00
R4299:Macf1 UTSW 4 123399406 missense probably damaging 1.00
R4326:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4327:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4355:Macf1 UTSW 4 123475091 missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123354492 intron probably benign
R4422:Macf1 UTSW 4 123466046 missense probably damaging 0.96
R4436:Macf1 UTSW 4 123527342 missense probably benign 0.03
R4472:Macf1 UTSW 4 123395989 missense probably damaging 1.00
R4515:Macf1 UTSW 4 123493988 missense probably damaging 1.00
R4549:Macf1 UTSW 4 123473693 missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4622:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4623:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4630:Macf1 UTSW 4 123473639 missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123473627 missense probably benign 0.01
R4650:Macf1 UTSW 4 123473619 missense probably benign 0.00
R4674:Macf1 UTSW 4 123472397 missense probably benign 0.22
R4751:Macf1 UTSW 4 123471650 missense probably benign 0.01
R4762:Macf1 UTSW 4 123455444 missense probably benign 0.00
R4776:Macf1 UTSW 4 123476015 missense probably benign 0.00
R4777:Macf1 UTSW 4 123376502 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4865:Macf1 UTSW 4 123433303 missense probably damaging 1.00
R4867:Macf1 UTSW 4 123472200 missense probably damaging 0.97
R4884:Macf1 UTSW 4 123455009 missense probably benign 0.02
R4890:Macf1 UTSW 4 123448238 missense probably damaging 1.00
R4913:Macf1 UTSW 4 123499889 missense probably damaging 1.00
R4925:Macf1 UTSW 4 123526652 missense probably benign
R4948:Macf1 UTSW 4 123497755 missense probably damaging 1.00
R4958:Macf1 UTSW 4 123475364 missense probably damaging 0.99
R4986:Macf1 UTSW 4 123391121 missense probably damaging 1.00
R4999:Macf1 UTSW 4 123494909 missense probably benign 0.14
R5004:Macf1 UTSW 4 123385475 missense probably damaging 1.00
R5017:Macf1 UTSW 4 123452113 missense probably damaging 1.00
R5018:Macf1 UTSW 4 123385599 missense probably damaging 1.00
R5026:Macf1 UTSW 4 123439494 missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123455519 missense probably damaging 0.97
R5039:Macf1 UTSW 4 123511220 missense probably damaging 1.00
R5041:Macf1 UTSW 4 123397046 intron probably null
R5100:Macf1 UTSW 4 123474468 missense probably benign 0.11
R5110:Macf1 UTSW 4 123368008 missense probably damaging 0.99
R5122:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R5187:Macf1 UTSW 4 123472089 missense probably benign 0.00
R5191:Macf1 UTSW 4 123472962 missense probably benign 0.00
R5201:Macf1 UTSW 4 123475945 nonsense probably null
R5236:Macf1 UTSW 4 123397821 missense probably damaging 1.00
R5248:Macf1 UTSW 4 123401774 nonsense probably null
R5251:Macf1 UTSW 4 123449967 missense probably benign 0.20
R5319:Macf1 UTSW 4 123473436 missense probably damaging 1.00
R5326:Macf1 UTSW 4 123350991 frame shift probably null
R5327:Macf1 UTSW 4 123350991 frame shift probably null
R5328:Macf1 UTSW 4 123350991 frame shift probably null
R5350:Macf1 UTSW 4 123527458 start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123471753 missense probably damaging 0.98
R5419:Macf1 UTSW 4 123397124 missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123384868 missense probably damaging 1.00
R5432:Macf1 UTSW 4 123459336 nonsense probably null
R5466:Macf1 UTSW 4 123452865 missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123450061 missense probably benign
R5564:Macf1 UTSW 4 123526745 missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123435164 missense probably damaging 0.98
R5597:Macf1 UTSW 4 123539777 intron probably benign
R5669:Macf1 UTSW 4 123476225 missense probably damaging 1.00
R5682:Macf1 UTSW 4 123434759 missense probably damaging 1.00
R5701:Macf1 UTSW 4 123503225 missense probably damaging 1.00
R5715:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R5760:Macf1 UTSW 4 123513884 missense probably damaging 1.00
R5806:Macf1 UTSW 4 123371887 missense probably damaging 1.00
R5838:Macf1 UTSW 4 123452154 missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123381324 missense probably damaging 1.00
R5850:Macf1 UTSW 4 123507306 missense probably damaging 1.00
R5875:Macf1 UTSW 4 123432314 missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123397158 missense probably damaging 1.00
R5913:Macf1 UTSW 4 123476039 missense probably damaging 1.00
R5921:Macf1 UTSW 4 123526711 missense probably benign
R5940:Macf1 UTSW 4 123432881 missense probably damaging 1.00
R5950:Macf1 UTSW 4 123439436 splice site probably null
R6005:Macf1 UTSW 4 123474275 missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123507333 missense probably damaging 1.00
R6041:Macf1 UTSW 4 123513848 missense probably damaging 1.00
R6057:Macf1 UTSW 4 123510743 missense probably damaging 0.98
R6156:Macf1 UTSW 4 123472280 missense probably benign 0.00
R6186:Macf1 UTSW 4 123484175 missense probably damaging 1.00
R6197:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R6262:Macf1 UTSW 4 123473190 missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123432875 missense probably damaging 1.00
R6340:Macf1 UTSW 4 123448249 missense probably benign 0.13
R6369:Macf1 UTSW 4 123410562 missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123493195 missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123401594 intron probably null
R6501:Macf1 UTSW 4 123469632 unclassified probably null
R6508:Macf1 UTSW 4 123469742 missense probably damaging 0.96
R6519:Macf1 UTSW 4 123472325 missense probably benign 0.13
R6535:Macf1 UTSW 4 123471935 missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123492725 missense probably damaging 1.00
R6546:Macf1 UTSW 4 123432281 missense probably benign 0.14
R6583:Macf1 UTSW 4 123470946 intron probably null
R6597:Macf1 UTSW 4 123382692 missense probably damaging 1.00
R6693:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123509803 missense probably damaging 1.00
R6704:Macf1 UTSW 4 123410762 intron probably benign
R6716:Macf1 UTSW 4 123508438 missense probably damaging 1.00
R6789:Macf1 UTSW 4 123372438 missense probably damaging 1.00
R6807:Macf1 UTSW 4 123374415 missense probably damaging 1.00
R6825:Macf1 UTSW 4 123383222 splice site probably null
R6881:Macf1 UTSW 4 123432453 missense probably damaging 1.00
R6894:Macf1 UTSW 4 123483687 missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123527352 missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123440722 missense probably benign 0.01
R6965:Macf1 UTSW 4 123408745 missense probably benign 0.38
R6969:Macf1 UTSW 4 123457800 missense probably benign 0.01
R7032:Macf1 UTSW 4 123472308 missense probably benign 0.00
R7055:Macf1 UTSW 4 123409196 missense probably benign 0.01
R7078:Macf1 UTSW 4 123432143 missense probably damaging 0.99
R7215:Macf1 UTSW 4 123507304 missense probably damaging 1.00
R7263:Macf1 UTSW 4 123378150 missense probably damaging 1.00
R7265:Macf1 UTSW 4 123407877 missense probably benign 0.00
R7278:Macf1 UTSW 4 123440743 missense possibly damaging 0.87
R7312:Macf1 UTSW 4 123506337 missense probably damaging 1.00
R7324:Macf1 UTSW 4 123374425 missense probably benign 0.09
R7334:Macf1 UTSW 4 123399442 missense probably damaging 1.00
R7342:Macf1 UTSW 4 123382124 missense probably damaging 1.00
R7409:Macf1 UTSW 4 123504470 missense probably damaging 1.00
R7436:Macf1 UTSW 4 123456643 missense probably benign
R7440:Macf1 UTSW 4 123455446 nonsense probably null
R7462:Macf1 UTSW 4 123492763 missense probably damaging 1.00
R7471:Macf1 UTSW 4 123472289 missense probably benign 0.00
R7472:Macf1 UTSW 4 123433067 missense probably benign 0.16
R7486:Macf1 UTSW 4 123409581 missense probably benign 0.00
R7492:Macf1 UTSW 4 123475731 missense possibly damaging 0.83
R7511:Macf1 UTSW 4 123473300 missense possibly damaging 0.72
R7528:Macf1 UTSW 4 123432059 missense possibly damaging 0.90
R7547:Macf1 UTSW 4 123441617 missense probably damaging 1.00
X0022:Macf1 UTSW 4 123450042 missense probably damaging 0.99
X0027:Macf1 UTSW 4 123503269 missense probably damaging 1.00
X0064:Macf1 UTSW 4 123511874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGGGCAGTAGGCTTCC -3'
(R):5'- CCTCTGATGAAGAAACGCTCAG -3'

Sequencing Primer
(F):5'- CAGGGCAGTAGGCTTCCTTTTTC -3'
(R):5'- CTCAGTGAGCGATCCTGTC -3'
Posted On2014-08-25