Incidental Mutation 'R1981:Tbx20'
ID222336
Institutional Source Beutler Lab
Gene Symbol Tbx20
Ensembl Gene ENSMUSG00000031965
Gene NameT-box 20
SynonymsTbx12, 9430010M06Rik
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24718138-24774303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24770913 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 48 (K48N)
Ref Sequence ENSEMBL: ENSMUSP00000126318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052946] [ENSMUST00000166018]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052946
AA Change: K48N

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: K48N

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
low complexity region 339 353 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166018
AA Change: K48N

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126318
Gene: ENSMUSG00000031965
AA Change: K48N

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217597
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Tbx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tbx20 APN 9 24758748 missense probably damaging 1.00
IGL00572:Tbx20 APN 9 24725688 missense probably benign
IGL01016:Tbx20 APN 9 24750321 missense probably damaging 1.00
IGL01317:Tbx20 APN 9 24769755 missense probably damaging 1.00
IGL02643:Tbx20 APN 9 24773713 unclassified probably benign
IGL02690:Tbx20 APN 9 24773737 missense probably benign 0.27
R0853:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0855:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0856:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R1781:Tbx20 UTSW 9 24725499 missense probably benign 0.00
R1840:Tbx20 UTSW 9 24725676 missense probably benign 0.22
R2063:Tbx20 UTSW 9 24769771 nonsense probably null
R2357:Tbx20 UTSW 9 24769776 missense possibly damaging 0.56
R4166:Tbx20 UTSW 9 24769744 missense probably damaging 1.00
R4790:Tbx20 UTSW 9 24725714 missense probably benign 0.34
R4904:Tbx20 UTSW 9 24758833 missense probably damaging 0.98
R5436:Tbx20 UTSW 9 24769720 missense probably damaging 1.00
R5799:Tbx20 UTSW 9 24725520 nonsense probably null
R5898:Tbx20 UTSW 9 24758859 missense probably damaging 1.00
R6914:Tbx20 UTSW 9 24725483 missense probably benign 0.19
R6962:Tbx20 UTSW 9 24769740 missense probably damaging 1.00
R7556:Tbx20 UTSW 9 24750277 intron probably null
Predicted Primers PCR Primer
(F):5'- GTGATTATCATCTCCGTGCCCAG -3'
(R):5'- GTCCCAGGTTCATTTGCACAG -3'

Sequencing Primer
(F):5'- GGAATTTGTCCCAGAGCTCC -3'
(R):5'- CCAGGTTCATTTGCACAGTTATG -3'
Posted On2014-08-25