Incidental Mutation 'R2013:Mogs'
ID222348
Institutional Source Beutler Lab
Gene Symbol Mogs
Ensembl Gene ENSMUSG00000030036
Gene Namemannosyl-oligosaccharide glucosidase
SynonymsGcs1, 1810017N02Rik
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83115496-83118898 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 83117650 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 483 (R483*)
Ref Sequence ENSEMBL: ENSMUSP00000032114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032109] [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113935] [ENSMUST00000113936] [ENSMUST00000143814] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032109
SMART Domains Protein: ENSMUSP00000032109
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 129 137 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
Pfam:PAPA-1 198 282 1.6e-27 PFAM
Pfam:zf-HIT 294 325 6.1e-10 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032114
AA Change: R483*
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036
AA Change: R483*

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113935
SMART Domains Protein: ENSMUSP00000109568
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
Pfam:PAPA-1 228 309 4e-23 PFAM
Pfam:zf-HIT 324 355 4.3e-11 PFAM
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123394
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142493
Predicted Effect probably benign
Transcript: ENSMUST00000143814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145403
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203069
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Mogs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mogs APN 6 83118577 missense probably damaging 1.00
IGL02314:Mogs APN 6 83118055 missense probably benign 0.00
IGL02673:Mogs APN 6 83118218 missense probably damaging 1.00
IGL02862:Mogs APN 6 83115890 missense probably damaging 1.00
IGL02984:Mogs UTSW 6 83117315 missense probably benign 0.00
R1547:Mogs UTSW 6 83116025 missense possibly damaging 0.93
R1765:Mogs UTSW 6 83116803 missense probably benign 0.00
R2015:Mogs UTSW 6 83117650 nonsense probably null
R3735:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R3736:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R4279:Mogs UTSW 6 83116067 missense probably damaging 1.00
R4585:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R4586:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R5783:Mogs UTSW 6 83118671 missense probably damaging 1.00
R5825:Mogs UTSW 6 83118212 missense possibly damaging 0.72
R6012:Mogs UTSW 6 83117382 missense probably damaging 1.00
R6753:Mogs UTSW 6 83115882 missense probably damaging 1.00
R7157:Mogs UTSW 6 83118507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAACAGAAAATGGACCCTGC -3'
(R):5'- TGCCTGACTTTGATGGAGC -3'

Sequencing Primer
(F):5'- GAAAATGGACCCTGCCCTGTTTC -3'
(R):5'- CCTGACTTTGATGGAGCCAAGAG -3'
Posted On2014-08-25