Incidental Mutation 'R1981:Rbm15b'
ID222351
Institutional Source Beutler Lab
Gene Symbol Rbm15b
Ensembl Gene ENSMUSG00000074102
Gene NameRNA binding motif protein 15B
Synonyms
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106880918-106887428 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 106881623 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000055843] [ENSMUST00000159645] [ENSMUST00000161758]
Predicted Effect probably benign
Transcript: ENSMUST00000055009
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000055843
SMART Domains Protein: ENSMUSP00000059330
Gene: ENSMUSG00000074102

DomainStartEndE-ValueType
low complexity region 5 41 N/A INTRINSIC
low complexity region 53 75 N/A INTRINSIC
low complexity region 78 133 N/A INTRINSIC
RRM 137 212 2.47e-2 SMART
low complexity region 216 251 N/A INTRINSIC
low complexity region 266 299 N/A INTRINSIC
RRM 334 406 2.03e-15 SMART
RRM 415 484 3.57e-11 SMART
low complexity region 653 675 N/A INTRINSIC
Pfam:SPOC 719 854 1.7e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000098424
AA Change: V82A
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159645
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161272
SMART Domains Protein: ENSMUSP00000125424
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 1 51 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161758
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163657
Predicted Effect probably benign
Transcript: ENSMUST00000185707
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15B, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Rbm15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Rbm15b APN 9 106885709 missense probably damaging 1.00
IGL02514:Rbm15b APN 9 106884977 missense probably damaging 0.96
IGL02585:Rbm15b APN 9 106885826 missense probably benign 0.22
IGL02814:Rbm15b APN 9 106885776 missense probably benign 0.12
IGL03110:Rbm15b APN 9 106885974 missense probably damaging 1.00
IGL03335:Rbm15b APN 9 106884339 missense probably damaging 0.99
R0004:Rbm15b UTSW 9 106884936 missense probably benign 0.02
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0390:Rbm15b UTSW 9 106885998 missense probably benign 0.03
R2966:Rbm15b UTSW 9 106885592 missense probably damaging 1.00
R4085:Rbm15b UTSW 9 106885737 missense possibly damaging 0.80
R4890:Rbm15b UTSW 9 106885829 missense possibly damaging 0.86
R5081:Rbm15b UTSW 9 106884921 missense probably benign 0.01
R5118:Rbm15b UTSW 9 106886102 missense possibly damaging 0.65
R5513:Rbm15b UTSW 9 106886117 missense probably benign 0.02
R7341:Rbm15b UTSW 9 106885047 missense probably benign 0.35
X0024:Rbm15b UTSW 9 106885379 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AAAGCATCAGGGGCTCATGC -3'
(R):5'- AGAGACTTTGCTGTTTTCTCTTCAG -3'

Sequencing Primer
(F):5'- CATCAGGGGCTCATGCTTTGC -3'
(R):5'- TCTTCAGCTGCATCCAGGAG -3'
Posted On2014-08-25