Incidental Mutation 'R1981:Aqp4'
ID222409
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Nameaquaporin 4
Synonymsaquaporin-4
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location15389394-15403684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15393551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 291 (D291G)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
Predicted Effect probably damaging
Transcript: ENSMUST00000079081
AA Change: D291G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: D291G

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1982:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R3033:Aqp4 UTSW 18 15393560 missense possibly damaging 0.80
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6334:Aqp4 UTSW 18 15393591 missense probably benign
R6856:Aqp4 UTSW 18 15399896 missense possibly damaging 0.88
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAAACCCGCAAGTGTC -3'
(R):5'- CCTTCTCCTCAGATATATTGGGTTGG -3'

Sequencing Primer
(F):5'- ACAAATCTGTTTCCTTAATGGGTGGC -3'
(R):5'- CTTAAGGAAGCCTTCAGC -3'
Posted On2014-08-25