Incidental Mutation 'R1981:Pax2'
ID222419
Institutional Source Beutler Lab
Gene Symbol Pax2
Ensembl Gene ENSMUSG00000004231
Gene Namepaired box 2
SynonymsPax-2, Opdc
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44756045-44837871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44818465 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 301 (D301N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000173346] [ENSMUST00000174490]
Predicted Effect probably damaging
Transcript: ENSMUST00000004340
AA Change: D300N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: D300N

DomainStartEndE-ValueType
PAX 15 139 4e-96 SMART
low complexity region 165 177 N/A INTRINSIC
SCOP:d1ftt__ 246 280 1e-4 SMART
Pfam:Pax2_C 300 415 1.1e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172880
AA Change: D301N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134174
Gene: ENSMUSG00000004231
AA Change: D301N

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 247 281 7e-5 SMART
Pfam:Pax2_C 304 415 5.5e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173346
AA Change: D274N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134311
Gene: ENSMUSG00000004231
AA Change: D274N

DomainStartEndE-ValueType
PAX 20 144 2.3e-96 SMART
low complexity region 170 182 N/A INTRINSIC
SCOP:d1ftt__ 220 254 5e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174490
AA Change: D278N

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: D278N

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 224 258 8e-5 SMART
Pfam:Pax2_C 278 393 6.3e-57 PFAM
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Pax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Pax2 APN 19 44790688 missense probably damaging 0.99
IGL02368:Pax2 APN 19 44835409 missense possibly damaging 0.55
IGL03146:Pax2 APN 19 44833275 splice site probably benign
bradybunch UTSW 19 44790736 missense probably damaging 0.99
R0084:Pax2 UTSW 19 44818435 missense probably damaging 1.00
R0554:Pax2 UTSW 19 44761861 missense probably damaging 1.00
R1116:Pax2 UTSW 19 44757424 missense probably damaging 0.99
R1951:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1952:Pax2 UTSW 19 44788832 missense probably benign 0.09
R3015:Pax2 UTSW 19 44816024 missense probably damaging 1.00
R4320:Pax2 UTSW 19 44835399 missense probably damaging 0.97
R4561:Pax2 UTSW 19 44835963 missense unknown
R4562:Pax2 UTSW 19 44835963 missense unknown
R4661:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R4948:Pax2 UTSW 19 44816040 missense probably damaging 1.00
R5131:Pax2 UTSW 19 44760955 missense probably damaging 0.98
R5622:Pax2 UTSW 19 44818466 missense probably damaging 1.00
R5661:Pax2 UTSW 19 44790722 missense probably damaging 1.00
R6110:Pax2 UTSW 19 44790736 missense probably damaging 0.99
R6171:Pax2 UTSW 19 44790740 missense probably damaging 1.00
R6713:Pax2 UTSW 19 44835477 missense unknown
R6791:Pax2 UTSW 19 44788821 missense possibly damaging 0.69
R7156:Pax2 UTSW 19 44788859 missense probably benign 0.00
X0018:Pax2 UTSW 19 44796676 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCTCCACTCAGCGTGTCAG -3'
(R):5'- ACTCTGCAGATACCATGGCAG -3'

Sequencing Primer
(F):5'- ACTCAGCGTGTCAGGTCCAC -3'
(R):5'- AGGGGGCCACTTGTCTCATTG -3'
Posted On2014-08-25