Incidental Mutation 'R2013:Maged1'
ID222478
Institutional Source Beutler Lab
Gene Symbol Maged1
Ensembl Gene ENSMUSG00000025151
Gene Namemelanoma antigen, family D, 1
Synonyms2810433C11Rik, DXBwg1492e, 5430405L04Rik, MAGE-D1, Dlxin-1, Nrage
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R2013 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location94535474-94542143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94536917 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 636 (Y636C)
Ref Sequence ENSEMBL: ENSMUSP00000026142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026142
AA Change: Y636C

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026142
Gene: ENSMUSG00000025151
AA Change: Y636C

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 418 436 N/A INTRINSIC
low complexity region 438 452 N/A INTRINSIC
MAGE 475 644 5.69e-85 SMART
coiled coil region 664 691 N/A INTRINSIC
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153386
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the melanoma antigen gene (MAGE) family. Most of the genes of this family encode tumor specific antigens that are not expressed in normal adult tissues except testis. Although the protein encoded by this gene shares strong homology with members of the MAGE family, it is expressed in almost all normal adult tissues. This gene has been demonstrated to be involved in the p75 neurotrophin receptor mediated programmed cell death pathway. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display defects in apoptotic signaling affecting hair cycling and neuronal physiology. Mice homozygous for a different knock-out allele exhibit hypoactivity, decreased exploration, social withdrawal, anhedonia, behavioral despair andaltered serotonin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Wdr33 C A 18: 31,888,976 Q860K unknown Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Maged1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2860:Maged1 UTSW X 94538924 missense probably damaging 0.99
R2861:Maged1 UTSW X 94538924 missense probably damaging 0.99
R2862:Maged1 UTSW X 94538924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCTTGGGTGTTGTTCCTCAG -3'
(R):5'- ATCCTGAGGCAACAACTTTAGC -3'

Sequencing Primer
(F):5'- ATAGGGTCTCTTAACAAGCAGGCTG -3'
(R):5'- GGCAACAACTTTAGCATAGTATGG -3'
Posted On2014-08-25