Incidental Mutation 'R2014:Mamdc4'
ID222496
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
MMRRC Submission 040023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2014 (G1)
Quality Score191
Status Validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25563572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1195 (D1195V)
Ref Sequence ENSEMBL: ENSMUSP00000109861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095117
AA Change: D1199V

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: D1199V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114223
AA Change: D1195V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: D1195V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152124
Predicted Effect unknown
Transcript: ENSMUST00000152237
AA Change: D1096V
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: D1096V

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153008
Meta Mutation Damage Score 0.0348 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
Acsbg2 T A 17: 56,853,855 K263M possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Adgrl2 C T 3: 148,826,475 G1041R probably damaging Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 Q36* probably null Het
Amer3 T C 1: 34,579,444 probably benign Het
Angptl8 T C 9: 21,837,062 probably null Het
Ankmy1 T C 1: 92,885,141 D482G probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Asb13 T G 13: 3,649,512 probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cd163 G T 6: 124,325,498 W1007L probably damaging Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cp A G 3: 19,987,434 K44E probably benign Het
Crtap C A 9: 114,381,585 probably null Het
Ctsk A G 3: 95,506,692 D250G probably damaging Het
Dcp2 T C 18: 44,410,296 V307A probably benign Het
Dnah6 T A 6: 73,173,419 D787V probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Espl1 C T 15: 102,322,714 R17* probably null Het
Espn G T 4: 152,132,959 probably null Het
Fam20b C T 1: 156,705,941 R35Q possibly damaging Het
Fga A G 3: 83,032,757 I573V probably damaging Het
Fmo5 A G 3: 97,635,682 K103E possibly damaging Het
Frem1 A T 4: 83,005,852 V291D probably damaging Het
Gabbr1 A G 17: 37,056,782 probably null Het
Gjb6 T C 14: 57,124,756 H16R probably damaging Het
Gm438 A T 4: 144,779,725 L132Q probably damaging Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Gulo T A 14: 66,009,047 M1L probably benign Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Heatr5b T C 17: 78,814,184 D704G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hps1 G A 19: 42,762,512 P350S probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kif21b T C 1: 136,148,282 F270L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt27 A G 11: 99,349,492 V200A probably benign Het
Lama3 T C 18: 12,524,721 probably benign Het
Lmcd1 T C 6: 112,328,741 W268R probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Map2 T C 1: 66,416,136 V1395A possibly damaging Het
Map3k20 C T 2: 72,438,260 T537M probably benign Het
Mdga1 A G 17: 29,849,313 S276P probably damaging Het
Mep1a T C 17: 43,497,906 N85D probably benign Het
Mettl16 A G 11: 74,817,369 S425G probably benign Het
Mthfd1l A G 10: 4,047,894 T622A probably benign Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nde1 A T 16: 14,169,457 probably benign Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc5 A G 8: 94,525,510 probably benign Het
Notch3 C A 17: 32,158,000 E310D probably benign Het
Olfr1180 T C 2: 88,412,044 T205A probably benign Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Olfr994 T A 2: 85,430,352 H159L possibly damaging Het
Osbpl5 C A 7: 143,741,692 C11F probably damaging Het
P4hb T C 11: 120,562,696 E381G probably damaging Het
Pax4 A G 6: 28,446,210 Y95H probably benign Het
Pdia3 T C 2: 121,434,820 V390A probably damaging Het
Pigv A C 4: 133,662,723 D49E possibly damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plxnb1 T A 9: 109,106,619 probably benign Het
Polq A G 16: 37,078,366 T2163A probably damaging Het
Pou5f2 T C 13: 78,025,853 S305P probably benign Het
Ppm1h A T 10: 122,920,725 H425L possibly damaging Het
Ppp1r13b G T 12: 111,833,788 D518E probably benign Het
Prf1 A T 10: 61,303,895 D544V probably benign Het
Prl3b1 T C 13: 27,247,965 F158L probably benign Het
Prss41 C T 17: 23,837,490 probably null Het
Prune2 T G 19: 17,120,523 N1130K probably damaging Het
Ptgdr2 T C 19: 10,940,425 F102S probably damaging Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rcbtb2 T C 14: 73,174,386 probably benign Het
Rgs14 C A 13: 55,383,700 S479* probably null Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sh2d4a A T 8: 68,331,083 Q223L probably damaging Het
Slc14a2 T C 18: 78,150,386 probably benign Het
Slc5a9 A C 4: 111,896,349 S52A possibly damaging Het
Slc6a18 C A 13: 73,675,725 V99L probably benign Het
Smarca2 T C 19: 26,683,905 S967P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tet3 T C 6: 83,386,075 E705G probably damaging Het
Tfeb T A 17: 47,791,559 H450Q probably damaging Het
Tmem248 G A 5: 130,231,812 E73K probably damaging Het
Trip12 A T 1: 84,760,866 L756* probably null Het
Try5 C T 6: 41,314,651 probably null Het
Tsc1 A T 2: 28,665,637 probably benign Het
Tspear G A 10: 77,875,120 probably benign Het
Ttc6 T C 12: 57,576,217 I134T possibly damaging Het
Ttn T A 2: 76,755,296 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Usp36 T C 11: 118,262,508 probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdr33 T C 18: 31,833,599 V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 Y269C possibly damaging Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense possibly damaging 0.88
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGACAGCTGCTGTTGAAAGG -3'
(R):5'- CTCCTTGACAGTAATCCTGGGAAC -3'

Sequencing Primer
(F):5'- CAGCTGCTGTTGAAAGGCAGTG -3'
(R):5'- GAACTGGGAACTATGTGGAGGTTC -3'
Posted On2014-08-25