Incidental Mutation 'R2014:1700015F17Rik'
ID222544
Institutional Source Beutler Lab
Gene Symbol 1700015F17Rik
Ensembl Gene ENSMUSG00000079666
Gene NameRIKEN cDNA 1700015F17 gene
SynonymsLOC381716
MMRRC Submission 040023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R2014 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5437827-5479143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5455964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 106 (I106L)
Ref Sequence ENSEMBL: ENSMUSP00000111107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115447] [ENSMUST00000128151] [ENSMUST00000156282]
Predicted Effect probably benign
Transcript: ENSMUST00000115447
AA Change: I106L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111107
Gene: ENSMUSG00000079666
AA Change: I106L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128151
Predicted Effect probably benign
Transcript: ENSMUST00000156282
SMART Domains Protein: ENSMUSP00000122651
Gene: ENSMUSG00000079666

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
Acsbg2 T A 17: 56,853,855 K263M possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Adgrl2 C T 3: 148,826,475 G1041R probably damaging Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 Q36* probably null Het
Amer3 T C 1: 34,579,444 probably benign Het
Angptl8 T C 9: 21,837,062 probably null Het
Ankmy1 T C 1: 92,885,141 D482G probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Asb13 T G 13: 3,649,512 probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cd163 G T 6: 124,325,498 W1007L probably damaging Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cp A G 3: 19,987,434 K44E probably benign Het
Crtap C A 9: 114,381,585 probably null Het
Ctsk A G 3: 95,506,692 D250G probably damaging Het
Dcp2 T C 18: 44,410,296 V307A probably benign Het
Dnah6 T A 6: 73,173,419 D787V probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Espl1 C T 15: 102,322,714 R17* probably null Het
Espn G T 4: 152,132,959 probably null Het
Fam20b C T 1: 156,705,941 R35Q possibly damaging Het
Fga A G 3: 83,032,757 I573V probably damaging Het
Fmo5 A G 3: 97,635,682 K103E possibly damaging Het
Frem1 A T 4: 83,005,852 V291D probably damaging Het
Gabbr1 A G 17: 37,056,782 probably null Het
Gjb6 T C 14: 57,124,756 H16R probably damaging Het
Gm438 A T 4: 144,779,725 L132Q probably damaging Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Gulo T A 14: 66,009,047 M1L probably benign Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Heatr5b T C 17: 78,814,184 D704G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hps1 G A 19: 42,762,512 P350S probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kif21b T C 1: 136,148,282 F270L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt27 A G 11: 99,349,492 V200A probably benign Het
Lama3 T C 18: 12,524,721 probably benign Het
Lmcd1 T C 6: 112,328,741 W268R probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Map2 T C 1: 66,416,136 V1395A possibly damaging Het
Map3k20 C T 2: 72,438,260 T537M probably benign Het
Mdga1 A G 17: 29,849,313 S276P probably damaging Het
Mep1a T C 17: 43,497,906 N85D probably benign Het
Mettl16 A G 11: 74,817,369 S425G probably benign Het
Mthfd1l A G 10: 4,047,894 T622A probably benign Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nde1 A T 16: 14,169,457 probably benign Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc5 A G 8: 94,525,510 probably benign Het
Notch3 C A 17: 32,158,000 E310D probably benign Het
Olfr1180 T C 2: 88,412,044 T205A probably benign Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Olfr994 T A 2: 85,430,352 H159L possibly damaging Het
Osbpl5 C A 7: 143,741,692 C11F probably damaging Het
P4hb T C 11: 120,562,696 E381G probably damaging Het
Pax4 A G 6: 28,446,210 Y95H probably benign Het
Pdia3 T C 2: 121,434,820 V390A probably damaging Het
Pigv A C 4: 133,662,723 D49E possibly damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plxnb1 T A 9: 109,106,619 probably benign Het
Polq A G 16: 37,078,366 T2163A probably damaging Het
Pou5f2 T C 13: 78,025,853 S305P probably benign Het
Ppm1h A T 10: 122,920,725 H425L possibly damaging Het
Ppp1r13b G T 12: 111,833,788 D518E probably benign Het
Prf1 A T 10: 61,303,895 D544V probably benign Het
Prl3b1 T C 13: 27,247,965 F158L probably benign Het
Prss41 C T 17: 23,837,490 probably null Het
Prune2 T G 19: 17,120,523 N1130K probably damaging Het
Ptgdr2 T C 19: 10,940,425 F102S probably damaging Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rcbtb2 T C 14: 73,174,386 probably benign Het
Rgs14 C A 13: 55,383,700 S479* probably null Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sh2d4a A T 8: 68,331,083 Q223L probably damaging Het
Slc14a2 T C 18: 78,150,386 probably benign Het
Slc5a9 A C 4: 111,896,349 S52A possibly damaging Het
Slc6a18 C A 13: 73,675,725 V99L probably benign Het
Smarca2 T C 19: 26,683,905 S967P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tet3 T C 6: 83,386,075 E705G probably damaging Het
Tfeb T A 17: 47,791,559 H450Q probably damaging Het
Tmem248 G A 5: 130,231,812 E73K probably damaging Het
Trip12 A T 1: 84,760,866 L756* probably null Het
Try5 C T 6: 41,314,651 probably null Het
Tsc1 A T 2: 28,665,637 probably benign Het
Tspear G A 10: 77,875,120 probably benign Het
Ttc6 T C 12: 57,576,217 I134T possibly damaging Het
Ttn T A 2: 76,755,296 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Usp36 T C 11: 118,262,508 probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdr33 T C 18: 31,833,599 V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 Y269C possibly damaging Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in 1700015F17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:1700015F17Rik APN 5 5450644 makesense probably null
IGL02701:1700015F17Rik APN 5 5466623 critical splice donor site probably null
IGL02821:1700015F17Rik APN 5 5452039 nonsense probably null
R1029:1700015F17Rik UTSW 5 5455919 missense probably benign 0.21
R1463:1700015F17Rik UTSW 5 5452073 splice site probably benign
R1525:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1550:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1764:1700015F17Rik UTSW 5 5478943 missense possibly damaging 0.83
R1911:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1912:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1930:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1931:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R2013:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2015:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2151:1700015F17Rik UTSW 5 5478875 missense possibly damaging 0.46
R2420:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R2421:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R3056:1700015F17Rik UTSW 5 5457283 critical splice donor site probably null
R4012:1700015F17Rik UTSW 5 5478955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATTCCTGTCTAGGCTGTTAC -3'
(R):5'- TTGGTCGTCTCATGAGAATGTAC -3'

Sequencing Primer
(F):5'- GTAGGGATTTTCACAGAAGCCTTCTC -3'
(R):5'- GTCGTCTCATGAGAATGTACTGTAC -3'
Posted On2014-08-25