Incidental Mutation 'R0140:Olfr628'
ID22255
Institutional Source Beutler Lab
Gene Symbol Olfr628
Ensembl Gene ENSMUSG00000096516
Gene Nameolfactory receptor 628
SynonymsGA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-4P, Olfr1526-ps1, MOR22-1
MMRRC Submission 038425-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0140 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location103730374-103733324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103732142 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000151622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098193] [ENSMUST00000218266]
Predicted Effect probably damaging
Transcript: ENSMUST00000098193
AA Change: D72G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095795
Gene: ENSMUSG00000096516
AA Change: D72G

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 2.3e-106 PFAM
Pfam:7tm_1 43 295 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218266
AA Change: D72G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
9330161L09Rik T C 12: 103,407,328 probably benign Het
Abca2 T G 2: 25,438,085 probably null Het
Adgrf3 T C 5: 30,196,381 K13R probably benign Het
Arhgap15 C A 2: 44,322,767 F416L probably damaging Het
Arhgef26 C G 3: 62,448,245 T746R probably benign Het
Aspm C T 1: 139,480,641 T2422I probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
AY358078 T A 14: 51,825,942 D348E probably benign Het
Blnk A T 19: 40,940,224 S285T probably damaging Het
Calr3 C T 8: 72,434,888 probably benign Het
Camsap2 A T 1: 136,280,382 V1124D probably benign Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Ccdc69 C A 11: 55,050,499 C196F possibly damaging Het
Cdhr3 T G 12: 33,080,413 N141T probably benign Het
Cdk4 T C 10: 127,064,345 V37A probably damaging Het
Celsr2 C T 3: 108,397,933 R2110K probably benign Het
Clcn7 A G 17: 25,153,754 Y437C probably damaging Het
Col6a6 A G 9: 105,702,275 F1917S probably damaging Het
Cps1 T G 1: 67,180,116 S872A probably benign Het
Crebbp G T 16: 4,117,499 T842N probably damaging Het
Dennd2d G A 3: 106,492,483 V234I probably benign Het
Fam227b T C 2: 126,124,603 M130V possibly damaging Het
Fbxw24 G T 9: 109,605,414 L373I possibly damaging Het
Fubp3 T C 2: 31,608,184 Y359H probably damaging Het
Gm19684 T C 17: 36,127,427 probably benign Het
Hrnr C T 3: 93,331,493 Q3013* probably null Het
Il12rb1 T C 8: 70,819,771 probably benign Het
Lepr A T 4: 101,768,067 D473V probably damaging Het
Myof A T 19: 37,951,556 Y820* probably null Het
Nfil3 G A 13: 52,967,645 Q408* probably null Het
Nolc1 G A 19: 46,081,378 probably benign Het
Npbwr1 A C 1: 5,916,621 Y225D probably damaging Het
Nrip3 T C 7: 109,761,815 probably benign Het
Ntrk1 A C 3: 87,778,568 L749R probably damaging Het
Olfr1115 A G 2: 87,252,625 I229M probably damaging Het
Olfr1261 T A 2: 89,994,119 V242D probably damaging Het
Olfr222 A G 11: 59,570,978 L254P probably damaging Het
Olfr801 G T 10: 129,669,688 T277N probably damaging Het
Paox A T 7: 140,134,058 T244S probably damaging Het
Pcdhb9 T A 18: 37,402,961 D669E possibly damaging Het
Pggt1b A G 18: 46,258,083 probably null Het
Phkg1 T A 5: 129,864,608 I334F probably benign Het
Phtf1 A T 3: 103,987,560 R208W probably null Het
Pnliprp2 A T 19: 58,766,363 I280F probably benign Het
Pnmal1 A G 7: 16,960,222 M1V probably null Het
Prcp A G 7: 92,928,611 T328A probably damaging Het
Pxdn A G 12: 29,982,754 E179G probably benign Het
Racgap1 A T 15: 99,623,651 N541K probably benign Het
Rnf103 T A 6: 71,509,331 F315L possibly damaging Het
Sept2 A G 1: 93,501,639 R237G probably damaging Het
Setd6 T A 8: 95,716,109 L58Q probably damaging Het
Sipa1l1 G A 12: 82,396,200 V755I probably damaging Het
Slc16a12 G T 19: 34,672,704 probably benign Het
Slk G A 19: 47,622,335 D815N probably damaging Het
Stx1a T C 5: 135,045,585 probably benign Het
Tbc1d15 T A 10: 115,220,219 I283F probably damaging Het
Tenm4 T C 7: 96,896,052 I2425T possibly damaging Het
Tle1 G A 4: 72,120,185 H702Y probably damaging Het
Tmc6 A G 11: 117,766,251 probably benign Het
Tmem268 G A 4: 63,577,859 R179H possibly damaging Het
Tmem9 A G 1: 136,034,162 K165R probably damaging Het
Trpm6 A G 19: 18,819,194 probably null Het
Tufm C T 7: 126,489,831 P88S probably damaging Het
Ubqln1 A G 13: 58,193,289 I216T probably damaging Het
Urad T G 5: 147,322,331 M1L probably benign Het
Utp6 A G 11: 79,956,725 probably benign Het
Vav2 C T 2: 27,273,676 probably benign Het
Vmn2r55 G T 7: 12,668,177 Q395K possibly damaging Het
Wwox T G 8: 114,706,287 V231G probably damaging Het
Zfp646 T A 7: 127,883,506 N1618K probably benign Het
Zzef1 G A 11: 72,899,551 M2110I possibly damaging Het
Other mutations in Olfr628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Olfr628 APN 7 103732480 missense possibly damaging 0.47
IGL02121:Olfr628 APN 7 103732469 missense probably damaging 1.00
R0505:Olfr628 UTSW 7 103732376 missense probably benign 0.09
R0582:Olfr628 UTSW 7 103732673 missense possibly damaging 0.82
R1585:Olfr628 UTSW 7 103732378 missense possibly damaging 0.56
R1907:Olfr628 UTSW 7 103731983 missense probably damaging 1.00
R4766:Olfr628 UTSW 7 103732250 missense possibly damaging 0.70
R4954:Olfr628 UTSW 7 103732207 missense probably damaging 1.00
R5464:Olfr628 UTSW 7 103732189 missense probably damaging 1.00
R6737:Olfr628 UTSW 7 103732150 missense probably damaging 1.00
R6761:Olfr628 UTSW 7 103732484 missense probably damaging 1.00
R6782:Olfr628 UTSW 7 103732342 missense possibly damaging 0.67
R7015:Olfr628 UTSW 7 103732817 missense probably null 0.85
R7503:Olfr628 UTSW 7 103732267 missense probably damaging 1.00
X0058:Olfr628 UTSW 7 103732282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCCAGTCTAGTTGAGAAGCC -3'
(R):5'- TGCCACATAACGGTCCATTGCC -3'

Sequencing Primer
(F):5'- CCATATGTCTACAGGTTGAGGCAG -3'
(R):5'- CATGGCAAACAAGATGCCTG -3'
Posted On2013-04-16