Incidental Mutation 'R2007:Dgkh'
ID222551
Institutional Source Beutler Lab
Gene Symbol Dgkh
Ensembl Gene ENSMUSG00000034731
Gene Namediacylglycerol kinase, eta
Synonyms5930402B05Rik
MMRRC Submission 040016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2007 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location78558750-78732776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78603049 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 530 (D530V)
Ref Sequence ENSEMBL: ENSMUSP00000154031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074729] [ENSMUST00000226342] [ENSMUST00000227537] [ENSMUST00000227767] [ENSMUST00000228362]
Predicted Effect probably benign
Transcript: ENSMUST00000074729
AA Change: D663V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074290
Gene: ENSMUSG00000034731
AA Change: D663V

DomainStartEndE-ValueType
low complexity region 12 32 N/A INTRINSIC
PH 63 157 1.91e-19 SMART
C1 173 222 1.35e-16 SMART
C1 245 295 1.66e-7 SMART
DAGKc 329 454 3.11e-62 SMART
low complexity region 654 667 N/A INTRINSIC
low complexity region 715 730 N/A INTRINSIC
DAGKa 762 919 1.74e-92 SMART
low complexity region 1124 1134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122498
Predicted Effect probably benign
Transcript: ENSMUST00000226342
AA Change: D663V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000227537
Predicted Effect probably benign
Transcript: ENSMUST00000227767
AA Change: D530V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228170
Predicted Effect probably benign
Transcript: ENSMUST00000228362
AA Change: D530V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Variation in this gene has been associated with bipolar disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Dchs1 A T 7: 105,755,325 V2670E probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
Eml6 C T 11: 29,848,814 probably null Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Foxp2 G A 6: 15,396,819 C381Y probably damaging Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Osbp T C 19: 11,973,901 M270T probably benign Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Sipa1l2 G A 8: 125,439,437 T1486I probably damaging Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Dgkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dgkh APN 14 78609593 missense possibly damaging 0.92
IGL00767:Dgkh APN 14 78587261 splice site probably benign
IGL00787:Dgkh APN 14 78618514 splice site probably benign
IGL01503:Dgkh APN 14 78616270 missense possibly damaging 0.96
IGL02308:Dgkh APN 14 78587576 missense probably benign 0.01
IGL02707:Dgkh APN 14 78585651 missense possibly damaging 0.75
IGL02987:Dgkh APN 14 78589872 critical splice donor site probably null
IGL03058:Dgkh APN 14 78627797 missense probably benign 0.23
IGL03341:Dgkh APN 14 78595491 splice site probably benign
PIT1430001:Dgkh UTSW 14 78581513 missense probably damaging 1.00
PIT4445001:Dgkh UTSW 14 78575942 missense possibly damaging 0.91
R0153:Dgkh UTSW 14 78570129 nonsense probably null
R0730:Dgkh UTSW 14 78584479 missense probably damaging 0.99
R1136:Dgkh UTSW 14 78624889 missense probably damaging 1.00
R1162:Dgkh UTSW 14 78624451 missense probably damaging 1.00
R1689:Dgkh UTSW 14 78618544 missense possibly damaging 0.86
R1771:Dgkh UTSW 14 78609527 missense probably damaging 1.00
R1861:Dgkh UTSW 14 78578792 missense probably benign 0.04
R1916:Dgkh UTSW 14 78595223 missense probably damaging 0.97
R1930:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1931:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1956:Dgkh UTSW 14 78618541 missense probably damaging 1.00
R3747:Dgkh UTSW 14 78584445 missense probably damaging 1.00
R4446:Dgkh UTSW 14 78628083 missense probably damaging 1.00
R4475:Dgkh UTSW 14 78589878 missense possibly damaging 0.80
R4965:Dgkh UTSW 14 78624421 missense probably damaging 1.00
R4970:Dgkh UTSW 14 78618637 missense probably damaging 1.00
R5071:Dgkh UTSW 14 78604532 missense probably damaging 1.00
R5652:Dgkh UTSW 14 78627761 missense probably damaging 1.00
R5726:Dgkh UTSW 14 78624902 missense probably benign 0.16
R5773:Dgkh UTSW 14 78595455 missense probably damaging 1.00
R5855:Dgkh UTSW 14 78624504 critical splice acceptor site probably null
R6041:Dgkh UTSW 14 78587627 missense probably damaging 1.00
R6192:Dgkh UTSW 14 78628064 nonsense probably null
R6868:Dgkh UTSW 14 78624853 missense probably damaging 0.99
R6981:Dgkh UTSW 14 78627742 nonsense probably null
R7095:Dgkh UTSW 14 78627784 missense probably benign 0.07
X0022:Dgkh UTSW 14 78595461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAACCTAACTCATACGTTGCC -3'
(R):5'- GACATCACTCCCAATTTGGTCAC -3'

Sequencing Primer
(F):5'- ACGTTGCCATTATTATTTTAGTGTTC -3'
(R):5'- ACTCCCAATTTGGTCACTAAATAATG -3'
Posted On2014-08-25