Incidental Mutation 'R2007:Osbp'
ID222576
Institutional Source Beutler Lab
Gene Symbol Osbp
Ensembl Gene ENSMUSG00000024687
Gene Nameoxysterol binding protein
Synonyms
MMRRC Submission 040016-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2007 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11965844-11994105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11973901 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 270 (M270T)
Ref Sequence ENSEMBL: ENSMUSP00000025590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025590]
Predicted Effect probably benign
Transcript: ENSMUST00000025590
AA Change: M270T

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025590
Gene: ENSMUSG00000024687
AA Change: M270T

DomainStartEndE-ValueType
PH 87 181 1.21e-21 SMART
low complexity region 187 196 N/A INTRINSIC
coiled coil region 288 324 N/A INTRINSIC
PDB:2RR3|B 344 377 3e-16 PDB
Pfam:Oxysterol_BP 416 791 8.8e-146 PFAM
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Oxysterol binding protein is an intracellular protein that is believed to transport sterols from lysosomes to the nucleus where the sterol down-regulates the genes for the LDL receptor, HMG-CoA reductase, and HMG synthetase [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Dchs1 A T 7: 105,755,325 V2670E probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dgkh T A 14: 78,603,049 D530V probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
Eml6 C T 11: 29,848,814 probably null Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Foxp2 G A 6: 15,396,819 C381Y probably damaging Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Sipa1l2 G A 8: 125,439,437 T1486I probably damaging Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Osbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01971:Osbp APN 19 11990635 missense probably benign 0.00
R0025:Osbp UTSW 19 11983958 missense probably damaging 1.00
R0025:Osbp UTSW 19 11983958 missense probably damaging 1.00
R0141:Osbp UTSW 19 11973859 missense possibly damaging 0.84
R0764:Osbp UTSW 19 11984156 splice site probably benign
R1583:Osbp UTSW 19 11977829 missense probably benign 0.18
R1808:Osbp UTSW 19 11970778 missense probably damaging 1.00
R1853:Osbp UTSW 19 11973891 missense possibly damaging 0.48
R2291:Osbp UTSW 19 11973834 nonsense probably null
R3788:Osbp UTSW 19 11978921 missense probably benign 0.00
R4082:Osbp UTSW 19 11978666 missense probably benign
R5240:Osbp UTSW 19 11978290 missense probably damaging 1.00
R5413:Osbp UTSW 19 11984491 missense probably damaging 1.00
R5825:Osbp UTSW 19 11970721 missense probably damaging 0.98
R5907:Osbp UTSW 19 11973876 missense probably damaging 1.00
R6255:Osbp UTSW 19 11977953 missense possibly damaging 0.64
R7226:Osbp UTSW 19 11978667 missense probably benign
X0024:Osbp UTSW 19 11978291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGATGAAGAGTCTGTCTCAC -3'
(R):5'- CAGCTGGTCCTGTTTCATGC -3'

Sequencing Primer
(F):5'- TGACAAGACCGAGCTCCAGAG -3'
(R):5'- GTCCTGTTTCATGCAACACACAATG -3'
Posted On2014-08-25