Incidental Mutation 'R1987:Slc4a10'
ID222596
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter-like, member 10
SynonymsNCBE
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1987 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location62046462-62326730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 62268204 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 561 (Q561K)
Ref Sequence ENSEMBL: ENSMUSP00000108099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
Predicted Effect probably damaging
Transcript: ENSMUST00000054484
AA Change: Q531K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: Q531K

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102735
AA Change: Q531K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: Q531K

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112480
AA Change: Q561K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: Q561K

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62290001 missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62286940 missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62253309 critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62268666 missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62190757 missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62228670 missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62268171 missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62190769 missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62286916 missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62268143 missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62288747 missense probably null 1.00
IGL03144:Slc4a10 APN 2 62250466 missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62296960 missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62267436 missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62250543 splice site probably benign
R0085:Slc4a10 UTSW 2 62244346 splice site probably benign
R0401:Slc4a10 UTSW 2 62190848 missense probably benign 0.27
R0433:Slc4a10 UTSW 2 62289983 missense probably benign 0.01
R0482:Slc4a10 UTSW 2 62297017 splice site probably benign
R0506:Slc4a10 UTSW 2 62250533 missense probably benign 0.13
R0511:Slc4a10 UTSW 2 62286862 missense probably damaging 0.97
R0590:Slc4a10 UTSW 2 62190893 splice site probably benign
R0883:Slc4a10 UTSW 2 62243398 missense probably benign 0.11
R1167:Slc4a10 UTSW 2 62228574 missense probably damaging 1.00
R1276:Slc4a10 UTSW 2 62250443 missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62313286 missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62286930 missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62257462 missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62324727 missense probably benign
R1848:Slc4a10 UTSW 2 62316606 missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62313343 missense probably benign
R4067:Slc4a10 UTSW 2 62046645 start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62317442 intron probably benign
R4255:Slc4a10 UTSW 2 62281936 missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62244343 splice site probably null
R4296:Slc4a10 UTSW 2 62234428 missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62243385 missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62296858 missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62257517 missense probably null 1.00
R4755:Slc4a10 UTSW 2 62296988 missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62268187 missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62257595 missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62244439 missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62267571 missense probably benign 0.06
R5223:Slc4a10 UTSW 2 62253366 missense probably damaging 1.00
R5244:Slc4a10 UTSW 2 62288725 missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62290058 missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62250472 missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62243431 missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62268872 missense probably benign 0.44
R6009:Slc4a10 UTSW 2 62046690 missense probably benign 0.00
R6015:Slc4a10 UTSW 2 62228702 missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62234465 missense probably damaging 1.00
R6141:Slc4a10 UTSW 2 62211445 missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62243357 splice site probably null
R6217:Slc4a10 UTSW 2 62303951 missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62281966 missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62286961 nonsense probably null
R6643:Slc4a10 UTSW 2 62228710 missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62250403 missense possibly damaging 0.55
U24488:Slc4a10 UTSW 2 62046658 missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62228599 missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62228571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGTTTCTAGGAATAACACAGTG -3'
(R):5'- GCAACTTCACATCCCATGGC -3'

Sequencing Primer
(F):5'- TTTCTAGGAATAACACAGTGAAAGG -3'
(R):5'- CAAGCTAGTAGGGGGTTCTTAGCAC -3'
Posted On2014-08-25