Incidental Mutation 'R1987:4932438A13Rik'
List [record 1 of 9592] next >> last >|
ID222613
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene NameRIKEN cDNA 4932438A13 gene
SynonymsTweek, FSA
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R1987 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36863104-37053033 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 36953985 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000211820]
Predicted Effect probably null
Transcript: ENSMUST00000057272
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152564
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211820
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37011727 missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36987299 missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37052547 utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37030751 splice site probably null
IGL00756:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37039462 missense probably benign
IGL00902:4932438A13Rik APN 3 37041345 missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37000041 missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37006984 critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37046280 missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37005013 splice site probably benign
IGL01370:4932438A13Rik APN 3 36947755 missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36973452 critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36942292 missense probably benign
IGL01419:4932438A13Rik APN 3 37048121 missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37003759 missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36887770 missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36996308 unclassified probably benign
IGL01520:4932438A13Rik APN 3 36973260 nonsense probably null
IGL01524:4932438A13Rik APN 3 36942382 missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37008485 missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36974311 missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36992673 splice site probably benign
IGL01717:4932438A13Rik APN 3 37034736 missense probably benign
IGL01767:4932438A13Rik APN 3 37041363 missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36928520 missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36957016 missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37004873 missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36906735 missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36969290 critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36921437 splice site probably benign
IGL02403:4932438A13Rik APN 3 37030664 missense probably benign
IGL02492:4932438A13Rik APN 3 37048113 missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36958868 missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36895315 missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37044608 nonsense probably null
IGL02620:4932438A13Rik APN 3 37035945 missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37041484 splice site probably benign
IGL02670:4932438A13Rik APN 3 36967305 nonsense probably null
IGL02806:4932438A13Rik APN 3 36946494 missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36958757 missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36965677 splice site probably benign
IGL03037:4932438A13Rik APN 3 36969207 missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36969208 missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37038517 splice site probably benign
IGL03137:4932438A13Rik APN 3 37034602 missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36948066 missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37050934 splice site probably benign
IGL03207:4932438A13Rik APN 3 36949996 missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36906683 splice site probably benign
IGL03264:4932438A13Rik APN 3 37002635 missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37047991 missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36870077 missense possibly damaging 0.90
FR4340:4932438A13Rik UTSW 3 37050752 critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37050754 critical splice acceptor site probably benign
R0035:4932438A13Rik UTSW 3 36987598 nonsense probably null
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37028159 missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0256:4932438A13Rik UTSW 3 36917773 missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0321:4932438A13Rik UTSW 3 36906788 splice site probably null
R0323:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0335:4932438A13Rik UTSW 3 36969152 missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37046252 missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36989804 missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37000065 missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36987635 missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37036825 missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36996458 missense probably benign 0.22
R0545:4932438A13Rik UTSW 3 36987690 splice site probably benign
R0674:4932438A13Rik UTSW 3 37044626 missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36928463 missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36946364 missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36959334 splice site probably benign
R1056:4932438A13Rik UTSW 3 36983453 missense possibly damaging 0.69
R1056:4932438A13Rik UTSW 3 37044680 missense probably benign 0.44
R1080:4932438A13Rik UTSW 3 36988255 missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36996523 missense probably benign
R1119:4932438A13Rik UTSW 3 36987045 missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37044631 missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36895303 missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36996312 unclassified probably benign
R1201:4932438A13Rik UTSW 3 36948375 missense probably benign
R1219:4932438A13Rik UTSW 3 36946470 nonsense probably null
R1270:4932438A13Rik UTSW 3 36952184 missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36987210 missense probably damaging 1.00
R1338:4932438A13Rik UTSW 3 37052535 missense unknown
R1364:4932438A13Rik UTSW 3 36987030 missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36942429 missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36965586 missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37008434 missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37052535 missense unknown
R1533:4932438A13Rik UTSW 3 37041375 missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36870056 missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36942399 missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37035812 nonsense probably null
R1772:4932438A13Rik UTSW 3 36959432 missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36908231 nonsense probably null
R1919:4932438A13Rik UTSW 3 37006983 critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36887865 missense probably null 1.00
R1992:4932438A13Rik UTSW 3 37000032 missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36908211 missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36895378 missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36928551 missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37047961 splice site probably benign
R2039:4932438A13Rik UTSW 3 37003878 missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36947853 missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36953970 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36875530 critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36885396 missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36958685 splice site probably null
R2860:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36947953 missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37007122 missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36958805 missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36875462 missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37011703 missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36959415 missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37041912 nonsense probably null
R3703:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37030565 missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37040434 missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36885398 missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37030061 missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37012575 intron probably benign
R4091:4932438A13Rik UTSW 3 37030589 missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36931083 missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36920236 missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36988147 nonsense probably null
R4413:4932438A13Rik UTSW 3 36958681 splice site probably null
R4475:4932438A13Rik UTSW 3 37040395 missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36895311 missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37030025 missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36889990 makesense probably null
R4705:4932438A13Rik UTSW 3 37041889 missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37004967 missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36942375 missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37022466 nonsense probably null
R4778:4932438A13Rik UTSW 3 36937065 missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36964968 missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36965937 missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36998199 missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36987165 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36917702 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36919901 missense probably benign 0.41
R4980:4932438A13Rik UTSW 3 36943312 missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36943399 intron probably benign
R5049:4932438A13Rik UTSW 3 37040506 intron probably benign
R5049:4932438A13Rik UTSW 3 37041390 missense probably damaging 1.00
R5089:4932438A13Rik UTSW 3 36987502 missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37000085 missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37034757 splice site probably null
R5210:4932438A13Rik UTSW 3 37033265 missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37048050 missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37000109 missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37048146 missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36917668 missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36875516 missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36917677 missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36917660 missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36921360 missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36958714 missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36992733 unclassified probably null
R5800:4932438A13Rik UTSW 3 37052443 missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37048600 missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37039526 missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36965621 missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36969221 missense possibly damaging 0.64
R5996:4932438A13Rik UTSW 3 36931116 missense probably benign 0.07
R6192:4932438A13Rik UTSW 3 36988169 missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36948304 missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36983471 missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36956999 missense probably benign
R6263:4932438A13Rik UTSW 3 36931111 missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36908228 missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37033307 missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37008443 missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36988085 missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37011566 critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36874282 missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37021481 missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36967189 missense probably damaging 1.00
X0050:4932438A13Rik UTSW 3 36957128 missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36987567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAGAACTTGTGAAATGCATGGG -3'
(R):5'- TAGCCAAACTATCAGCAAAAGTAGG -3'

Sequencing Primer
(F):5'- GCATGGGAATTAATTTTGTTCAATGC -3'
(R):5'- ACTACGTGTTGACTCCAAGG -3'
Posted On2014-08-25