Incidental Mutation 'R2014:Slc6a18'
ID222636
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 18
SynonymsXtrp2, D630001K16Rik, XT2
MMRRC Submission 040023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2014 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73661752-73678023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73675725 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 99 (V99L)
Ref Sequence ENSEMBL: ENSMUSP00000152273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000221026] [ENSMUST00000221987] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
Predicted Effect probably benign
Transcript: ENSMUST00000022048
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022105
AA Change: V99L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: V99L

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109679
AA Change: V99L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: V99L

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109680
AA Change: V99L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: V99L

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132085
Predicted Effect probably benign
Transcript: ENSMUST00000220650
AA Change: V99L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000221026
AA Change: V99L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000221987
AA Change: V99L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222029
AA Change: V99L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000223026
AA Change: V99L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000223074
AA Change: V99L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
Acsbg2 T A 17: 56,853,855 K263M possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Adgrl2 C T 3: 148,826,475 G1041R probably damaging Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 Q36* probably null Het
Amer3 T C 1: 34,579,444 probably benign Het
Angptl8 T C 9: 21,837,062 probably null Het
Ankmy1 T C 1: 92,885,141 D482G probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Asb13 T G 13: 3,649,512 probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cd163 G T 6: 124,325,498 W1007L probably damaging Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cp A G 3: 19,987,434 K44E probably benign Het
Crtap C A 9: 114,381,585 probably null Het
Ctsk A G 3: 95,506,692 D250G probably damaging Het
Dcp2 T C 18: 44,410,296 V307A probably benign Het
Dnah6 T A 6: 73,173,419 D787V probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Espl1 C T 15: 102,322,714 R17* probably null Het
Espn G T 4: 152,132,959 probably null Het
Fam20b C T 1: 156,705,941 R35Q possibly damaging Het
Fga A G 3: 83,032,757 I573V probably damaging Het
Fmo5 A G 3: 97,635,682 K103E possibly damaging Het
Frem1 A T 4: 83,005,852 V291D probably damaging Het
Gabbr1 A G 17: 37,056,782 probably null Het
Gjb6 T C 14: 57,124,756 H16R probably damaging Het
Gm438 A T 4: 144,779,725 L132Q probably damaging Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Gulo T A 14: 66,009,047 M1L probably benign Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Heatr5b T C 17: 78,814,184 D704G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hps1 G A 19: 42,762,512 P350S probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kif21b T C 1: 136,148,282 F270L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt27 A G 11: 99,349,492 V200A probably benign Het
Lama3 T C 18: 12,524,721 probably benign Het
Lmcd1 T C 6: 112,328,741 W268R probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Map2 T C 1: 66,416,136 V1395A possibly damaging Het
Map3k20 C T 2: 72,438,260 T537M probably benign Het
Mdga1 A G 17: 29,849,313 S276P probably damaging Het
Mep1a T C 17: 43,497,906 N85D probably benign Het
Mettl16 A G 11: 74,817,369 S425G probably benign Het
Mthfd1l A G 10: 4,047,894 T622A probably benign Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nde1 A T 16: 14,169,457 probably benign Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc5 A G 8: 94,525,510 probably benign Het
Notch3 C A 17: 32,158,000 E310D probably benign Het
Olfr1180 T C 2: 88,412,044 T205A probably benign Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Olfr994 T A 2: 85,430,352 H159L possibly damaging Het
Osbpl5 C A 7: 143,741,692 C11F probably damaging Het
P4hb T C 11: 120,562,696 E381G probably damaging Het
Pax4 A G 6: 28,446,210 Y95H probably benign Het
Pdia3 T C 2: 121,434,820 V390A probably damaging Het
Pigv A C 4: 133,662,723 D49E possibly damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plxnb1 T A 9: 109,106,619 probably benign Het
Polq A G 16: 37,078,366 T2163A probably damaging Het
Pou5f2 T C 13: 78,025,853 S305P probably benign Het
Ppm1h A T 10: 122,920,725 H425L possibly damaging Het
Ppp1r13b G T 12: 111,833,788 D518E probably benign Het
Prf1 A T 10: 61,303,895 D544V probably benign Het
Prl3b1 T C 13: 27,247,965 F158L probably benign Het
Prss41 C T 17: 23,837,490 probably null Het
Prune2 T G 19: 17,120,523 N1130K probably damaging Het
Ptgdr2 T C 19: 10,940,425 F102S probably damaging Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rcbtb2 T C 14: 73,174,386 probably benign Het
Rgs14 C A 13: 55,383,700 S479* probably null Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sh2d4a A T 8: 68,331,083 Q223L probably damaging Het
Slc14a2 T C 18: 78,150,386 probably benign Het
Slc5a9 A C 4: 111,896,349 S52A possibly damaging Het
Smarca2 T C 19: 26,683,905 S967P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tet3 T C 6: 83,386,075 E705G probably damaging Het
Tfeb T A 17: 47,791,559 H450Q probably damaging Het
Tmem248 G A 5: 130,231,812 E73K probably damaging Het
Trip12 A T 1: 84,760,866 L756* probably null Het
Try5 C T 6: 41,314,651 probably null Het
Tsc1 A T 2: 28,665,637 probably benign Het
Tspear G A 10: 77,875,120 probably benign Het
Ttc6 T C 12: 57,576,217 I134T possibly damaging Het
Ttn T A 2: 76,755,296 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Usp36 T C 11: 118,262,508 probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdr33 T C 18: 31,833,599 V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 Y269C possibly damaging Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73677879 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73677802 missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73668159 missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73668159 missense probably benign 0.21
R6640:Slc6a18 UTSW 13 73664282 missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
R7267:Slc6a18 UTSW 13 73671636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGCATCCAGGACCAGGTAG -3'
(R):5'- CCACACTGATATGCTATGGGC -3'

Sequencing Primer
(F):5'- TAGGCAATGAGTGGAACCCTTC -3'
(R):5'- TATGGGCAGCCAGGAGC -3'
Posted On2014-08-25