Incidental Mutation 'R2014:Vps13b'
ID222646
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Namevacuolar protein sorting 13B
Synonyms2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 040023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2014 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location35371160-35931229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35607142 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1074 (S1074P)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: S1074P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: S1074P

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226579
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
Acsbg2 T A 17: 56,853,855 K263M possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Adgrl2 C T 3: 148,826,475 G1041R probably damaging Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 Q36* probably null Het
Amer3 T C 1: 34,579,444 probably benign Het
Angptl8 T C 9: 21,837,062 probably null Het
Ankmy1 T C 1: 92,885,141 D482G probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Asb13 T G 13: 3,649,512 probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cd163 G T 6: 124,325,498 W1007L probably damaging Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cp A G 3: 19,987,434 K44E probably benign Het
Crtap C A 9: 114,381,585 probably null Het
Ctsk A G 3: 95,506,692 D250G probably damaging Het
Dcp2 T C 18: 44,410,296 V307A probably benign Het
Dnah6 T A 6: 73,173,419 D787V probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Espl1 C T 15: 102,322,714 R17* probably null Het
Espn G T 4: 152,132,959 probably null Het
Fam20b C T 1: 156,705,941 R35Q possibly damaging Het
Fga A G 3: 83,032,757 I573V probably damaging Het
Fmo5 A G 3: 97,635,682 K103E possibly damaging Het
Frem1 A T 4: 83,005,852 V291D probably damaging Het
Gabbr1 A G 17: 37,056,782 probably null Het
Gjb6 T C 14: 57,124,756 H16R probably damaging Het
Gm438 A T 4: 144,779,725 L132Q probably damaging Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Gulo T A 14: 66,009,047 M1L probably benign Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Heatr5b T C 17: 78,814,184 D704G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hps1 G A 19: 42,762,512 P350S probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kif21b T C 1: 136,148,282 F270L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt27 A G 11: 99,349,492 V200A probably benign Het
Lama3 T C 18: 12,524,721 probably benign Het
Lmcd1 T C 6: 112,328,741 W268R probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Map2 T C 1: 66,416,136 V1395A possibly damaging Het
Map3k20 C T 2: 72,438,260 T537M probably benign Het
Mdga1 A G 17: 29,849,313 S276P probably damaging Het
Mep1a T C 17: 43,497,906 N85D probably benign Het
Mettl16 A G 11: 74,817,369 S425G probably benign Het
Mthfd1l A G 10: 4,047,894 T622A probably benign Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nde1 A T 16: 14,169,457 probably benign Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc5 A G 8: 94,525,510 probably benign Het
Notch3 C A 17: 32,158,000 E310D probably benign Het
Olfr1180 T C 2: 88,412,044 T205A probably benign Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Olfr994 T A 2: 85,430,352 H159L possibly damaging Het
Osbpl5 C A 7: 143,741,692 C11F probably damaging Het
P4hb T C 11: 120,562,696 E381G probably damaging Het
Pax4 A G 6: 28,446,210 Y95H probably benign Het
Pdia3 T C 2: 121,434,820 V390A probably damaging Het
Pigv A C 4: 133,662,723 D49E possibly damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plxnb1 T A 9: 109,106,619 probably benign Het
Polq A G 16: 37,078,366 T2163A probably damaging Het
Pou5f2 T C 13: 78,025,853 S305P probably benign Het
Ppm1h A T 10: 122,920,725 H425L possibly damaging Het
Ppp1r13b G T 12: 111,833,788 D518E probably benign Het
Prf1 A T 10: 61,303,895 D544V probably benign Het
Prl3b1 T C 13: 27,247,965 F158L probably benign Het
Prss41 C T 17: 23,837,490 probably null Het
Prune2 T G 19: 17,120,523 N1130K probably damaging Het
Ptgdr2 T C 19: 10,940,425 F102S probably damaging Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rcbtb2 T C 14: 73,174,386 probably benign Het
Rgs14 C A 13: 55,383,700 S479* probably null Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sh2d4a A T 8: 68,331,083 Q223L probably damaging Het
Slc14a2 T C 18: 78,150,386 probably benign Het
Slc5a9 A C 4: 111,896,349 S52A possibly damaging Het
Slc6a18 C A 13: 73,675,725 V99L probably benign Het
Smarca2 T C 19: 26,683,905 S967P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tet3 T C 6: 83,386,075 E705G probably damaging Het
Tfeb T A 17: 47,791,559 H450Q probably damaging Het
Tmem248 G A 5: 130,231,812 E73K probably damaging Het
Trip12 A T 1: 84,760,866 L756* probably null Het
Try5 C T 6: 41,314,651 probably null Het
Tsc1 A T 2: 28,665,637 probably benign Het
Tspear G A 10: 77,875,120 probably benign Het
Ttc6 T C 12: 57,576,217 I134T possibly damaging Het
Ttn T A 2: 76,755,296 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Usp36 T C 11: 118,262,508 probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdr33 T C 18: 31,833,599 V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 Y269C possibly damaging Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGGTTTATAGCTTAAAGCAATGC -3'
(R):5'- AACGGAATCTCCTGCAGAGG -3'

Sequencing Primer
(F):5'- GAGACAAGGTTTCTCTGTATAGCCC -3'
(R):5'- CAGAGGTTCCATGTACTTGTGACC -3'
Posted On2014-08-25