Incidental Mutation 'R1987:Nlrp9c'
ID222659
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1987 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26378056 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 767 (M767T)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably benign
Transcript: ENSMUST00000041845
AA Change: M712T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: M712T

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085944
AA Change: M767T

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: M767T

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160948
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6885:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATCTGAGGCATAGATAGTGAC -3'
(R):5'- TGGGGCATTTGTCTAAGCAATAC -3'

Sequencing Primer
(F):5'- TGACAGAGTCTAATGGCATAACAC -3'
(R):5'- GGCATTTGTCTAAGCAATACACAGTC -3'
Posted On2014-08-25