Incidental Mutation 'R1987:Prrt2'
ID222674
Institutional Source Beutler Lab
Gene Symbol Prrt2
Ensembl Gene ENSMUSG00000045114
Gene Nameproline-rich transmembrane protein 2
Synonyms
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1987 (G1)
Quality Score186
Status Not validated
Chromosome7
Chromosomal Location127017531-127021211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127018730 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000144042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032916] [ENSMUST00000159916] [ENSMUST00000161931] [ENSMUST00000162069] [ENSMUST00000165096] [ENSMUST00000200948] [ENSMUST00000202045] [ENSMUST00000202624] [ENSMUST00000202798] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000206254] [ENSMUST00000206416]
Predicted Effect probably benign
Transcript: ENSMUST00000032916
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032918
SMART Domains Protein: ENSMUSP00000032918
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159916
AA Change: V344A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124520
Gene: ENSMUSG00000045114
AA Change: V344A

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
Pfam:CD225 263 337 3.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161728
Predicted Effect probably benign
Transcript: ENSMUST00000161931
SMART Domains Protein: ENSMUSP00000143833
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162069
SMART Domains Protein: ENSMUSP00000123889
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 55 2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165096
SMART Domains Protein: ENSMUSP00000127250
Gene: ENSMUSG00000030681

DomainStartEndE-ValueType
Pfam:Vault 122 163 5.4e-18 PFAM
Pfam:Vault 175 215 7.7e-16 PFAM
Pfam:Vault 228 271 7.9e-14 PFAM
Pfam:Vault 333 377 2.8e-16 PFAM
Pfam:MVP_shoulder 528 656 5.9e-55 PFAM
low complexity region 707 720 N/A INTRINSIC
low complexity region 733 749 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172958
SMART Domains Protein: ENSMUSP00000134420
Gene: ENSMUSG00000092534

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 72 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200948
SMART Domains Protein: ENSMUSP00000144469
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201606
Predicted Effect probably benign
Transcript: ENSMUST00000201686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201963
Predicted Effect probably benign
Transcript: ENSMUST00000202045
AA Change: V59A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000144042
Gene: ENSMUSG00000045114
AA Change: V59A

DomainStartEndE-ValueType
Pfam:CD225 1 52 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202624
SMART Domains Protein: ENSMUSP00000144099
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 176 5.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202798
SMART Domains Protein: ENSMUSP00000144243
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202936
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect probably benign
Transcript: ENSMUST00000205568
Predicted Effect probably benign
Transcript: ENSMUST00000206254
Predicted Effect probably benign
Transcript: ENSMUST00000206416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206953
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele develop paroxysmal movements (bouncing and back walking) at the onset of locomotion and exhibit wild running and jumping in response to audiogenic stimuli and an increased sensitivity to the convulsive effects of pentylentetrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Prrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2012:Prrt2 UTSW 7 127019409 missense probably damaging 1.00
R2504:Prrt2 UTSW 7 127020224 missense possibly damaging 0.84
R5622:Prrt2 UTSW 7 127019765 missense probably benign 0.02
R5655:Prrt2 UTSW 7 127019402 missense probably damaging 1.00
R5699:Prrt2 UTSW 7 127018727 missense probably benign 0.00
R5704:Prrt2 UTSW 7 127019418 missense probably damaging 1.00
R6765:Prrt2 UTSW 7 127019597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTTTCAGAGTGCAGG -3'
(R):5'- ATCAACTTAGGCGGTGAGTG -3'

Sequencing Primer
(F):5'- CTATGGCTGGCAGAGGAGC -3'
(R):5'- TGAGTGGGGGTCAGGGAC -3'
Posted On2014-08-25