Incidental Mutation 'R1987:2610507B11Rik'
ID222692
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1987 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78268167 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 433 (Q433L)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably damaging
Transcript: ENSMUST00000010421
AA Change: Q433L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: Q433L

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141331
Predicted Effect probably benign
Transcript: ENSMUST00000145145
SMART Domains Protein: ENSMUSP00000119105
Gene: ENSMUSG00000010277

DomainStartEndE-ValueType
Pfam:Fmp27_GFWDK 1 52 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTGTAGCTGTGGCCAGG -3'
(R):5'- AGCAGAGATGATCTACAGTTAGCAC -3'

Sequencing Primer
(F):5'- GGCCCAAAACTAAACTGTCAG -3'
(R):5'- TAGCACTGCTCGCTGATGGATAC -3'
Posted On2014-08-25