Incidental Mutation 'R2014:Smarca2'
ID222715
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
MMRRC Submission 040023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2014 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26683905 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 967 (S967P)
Ref Sequence ENSEMBL: ENSMUSP00000097135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025862
AA Change: S967P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: S967P

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099537
AA Change: S967P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: S967P

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175935
Predicted Effect probably benign
Transcript: ENSMUST00000176030
AA Change: S967P

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: S967P

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176769
AA Change: S909P

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: S909P

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208303
AA Change: S211P
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
Acsbg2 T A 17: 56,853,855 K263M possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Adgrl2 C T 3: 148,826,475 G1041R probably damaging Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 Q36* probably null Het
Amer3 T C 1: 34,579,444 probably benign Het
Angptl8 T C 9: 21,837,062 probably null Het
Ankmy1 T C 1: 92,885,141 D482G probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Asb13 T G 13: 3,649,512 probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cd163 G T 6: 124,325,498 W1007L probably damaging Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cp A G 3: 19,987,434 K44E probably benign Het
Crtap C A 9: 114,381,585 probably null Het
Ctsk A G 3: 95,506,692 D250G probably damaging Het
Dcp2 T C 18: 44,410,296 V307A probably benign Het
Dnah6 T A 6: 73,173,419 D787V probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Espl1 C T 15: 102,322,714 R17* probably null Het
Espn G T 4: 152,132,959 probably null Het
Fam20b C T 1: 156,705,941 R35Q possibly damaging Het
Fga A G 3: 83,032,757 I573V probably damaging Het
Fmo5 A G 3: 97,635,682 K103E possibly damaging Het
Frem1 A T 4: 83,005,852 V291D probably damaging Het
Gabbr1 A G 17: 37,056,782 probably null Het
Gjb6 T C 14: 57,124,756 H16R probably damaging Het
Gm438 A T 4: 144,779,725 L132Q probably damaging Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Gulo T A 14: 66,009,047 M1L probably benign Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Heatr5b T C 17: 78,814,184 D704G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hps1 G A 19: 42,762,512 P350S probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kif21b T C 1: 136,148,282 F270L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt27 A G 11: 99,349,492 V200A probably benign Het
Lama3 T C 18: 12,524,721 probably benign Het
Lmcd1 T C 6: 112,328,741 W268R probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Map2 T C 1: 66,416,136 V1395A possibly damaging Het
Map3k20 C T 2: 72,438,260 T537M probably benign Het
Mdga1 A G 17: 29,849,313 S276P probably damaging Het
Mep1a T C 17: 43,497,906 N85D probably benign Het
Mettl16 A G 11: 74,817,369 S425G probably benign Het
Mthfd1l A G 10: 4,047,894 T622A probably benign Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nde1 A T 16: 14,169,457 probably benign Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc5 A G 8: 94,525,510 probably benign Het
Notch3 C A 17: 32,158,000 E310D probably benign Het
Olfr1180 T C 2: 88,412,044 T205A probably benign Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Olfr994 T A 2: 85,430,352 H159L possibly damaging Het
Osbpl5 C A 7: 143,741,692 C11F probably damaging Het
P4hb T C 11: 120,562,696 E381G probably damaging Het
Pax4 A G 6: 28,446,210 Y95H probably benign Het
Pdia3 T C 2: 121,434,820 V390A probably damaging Het
Pigv A C 4: 133,662,723 D49E possibly damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plxnb1 T A 9: 109,106,619 probably benign Het
Polq A G 16: 37,078,366 T2163A probably damaging Het
Pou5f2 T C 13: 78,025,853 S305P probably benign Het
Ppm1h A T 10: 122,920,725 H425L possibly damaging Het
Ppp1r13b G T 12: 111,833,788 D518E probably benign Het
Prf1 A T 10: 61,303,895 D544V probably benign Het
Prl3b1 T C 13: 27,247,965 F158L probably benign Het
Prss41 C T 17: 23,837,490 probably null Het
Prune2 T G 19: 17,120,523 N1130K probably damaging Het
Ptgdr2 T C 19: 10,940,425 F102S probably damaging Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rcbtb2 T C 14: 73,174,386 probably benign Het
Rgs14 C A 13: 55,383,700 S479* probably null Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sh2d4a A T 8: 68,331,083 Q223L probably damaging Het
Slc14a2 T C 18: 78,150,386 probably benign Het
Slc5a9 A C 4: 111,896,349 S52A possibly damaging Het
Slc6a18 C A 13: 73,675,725 V99L probably benign Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tet3 T C 6: 83,386,075 E705G probably damaging Het
Tfeb T A 17: 47,791,559 H450Q probably damaging Het
Tmem248 G A 5: 130,231,812 E73K probably damaging Het
Trip12 A T 1: 84,760,866 L756* probably null Het
Try5 C T 6: 41,314,651 probably null Het
Tsc1 A T 2: 28,665,637 probably benign Het
Tspear G A 10: 77,875,120 probably benign Het
Ttc6 T C 12: 57,576,217 I134T possibly damaging Het
Ttn T A 2: 76,755,296 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Usp36 T C 11: 118,262,508 probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdr33 T C 18: 31,833,599 V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 Y269C possibly damaging Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTCAATCTGGCTTGATAGC -3'
(R):5'- CCAGACTGAAAATGGGATGCC -3'

Sequencing Primer
(F):5'- GTGTGATTTCAGTAGGCAATGAAATC -3'
(R):5'- GCTCTCTCACACCCAGAGG -3'
Posted On2014-08-25