Incidental Mutation 'R1987:Tbc1d24'
ID222749
Institutional Source Beutler Lab
Gene Symbol Tbc1d24
Ensembl Gene ENSMUSG00000036473
Gene NameTBC1 domain family, member 24
Synonyms
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1987 (G1)
Quality Score157
Status Not validated
Chromosome17
Chromosomal Location24175431-24209387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24206872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 490 (V490A)
Ref Sequence ENSEMBL: ENSMUSP00000024931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024931] [ENSMUST00000040474] [ENSMUST00000097376] [ENSMUST00000167791] [ENSMUST00000168410] [ENSMUST00000201089] [ENSMUST00000201301] [ENSMUST00000201359] [ENSMUST00000201583] [ENSMUST00000201805] [ENSMUST00000201960] [ENSMUST00000202925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024931
AA Change: V490A

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024931
Gene: ENSMUSG00000036473
AA Change: V490A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LamNT 34 253 8.83e-89 SMART
EGF_Lam 255 308 3.03e-5 SMART
EGF_Lam 311 371 1.29e-8 SMART
EGF_Lam 374 421 9.83e-14 SMART
C345C 456 571 2.72e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040474
SMART Domains Protein: ENSMUSP00000036458
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097376
SMART Domains Protein: ENSMUSP00000094989
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148704
Predicted Effect probably benign
Transcript: ENSMUST00000167791
SMART Domains Protein: ENSMUSP00000127005
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.6e-6 SMART
TLDc 342 556 7.6e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168410
SMART Domains Protein: ENSMUSP00000128868
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171563
Predicted Effect probably benign
Transcript: ENSMUST00000201089
SMART Domains Protein: ENSMUSP00000144250
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201301
SMART Domains Protein: ENSMUSP00000143949
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201359
SMART Domains Protein: ENSMUSP00000144026
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
Blast:TLDc 283 321 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000201583
SMART Domains Protein: ENSMUSP00000144097
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TLDc 1 182 5.2e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201716
Predicted Effect probably benign
Transcript: ENSMUST00000201805
SMART Domains Protein: ENSMUSP00000143883
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201960
SMART Domains Protein: ENSMUSP00000144208
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202925
SMART Domains Protein: ENSMUSP00000144575
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Tbc1d24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Tbc1d24 APN 17 24185828 missense probably damaging 1.00
IGL01511:Tbc1d24 APN 17 24181918 missense probably benign 0.00
IGL02499:Tbc1d24 APN 17 24207619 unclassified probably null
IGL02706:Tbc1d24 APN 17 24185421 missense probably benign 0.32
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1529:Tbc1d24 UTSW 17 24185979 missense probably damaging 1.00
R1985:Tbc1d24 UTSW 17 24207964 nonsense probably null
R2425:Tbc1d24 UTSW 17 24186008 missense probably damaging 0.99
R2902:Tbc1d24 UTSW 17 24207246 missense probably benign 0.01
R4622:Tbc1d24 UTSW 17 24208891 missense probably benign 0.03
R4946:Tbc1d24 UTSW 17 24208536 missense possibly damaging 0.94
R5428:Tbc1d24 UTSW 17 24181772 missense probably benign 0.34
R5890:Tbc1d24 UTSW 17 24185526 missense probably damaging 1.00
R5991:Tbc1d24 UTSW 17 24209069 unclassified probably benign
R6002:Tbc1d24 UTSW 17 24183787 start codon destroyed probably null 1.00
R6145:Tbc1d24 UTSW 17 24208229 missense probably damaging 1.00
R6245:Tbc1d24 UTSW 17 24185993 missense probably damaging 1.00
R6399:Tbc1d24 UTSW 17 24208329 missense probably damaging 0.97
R6764:Tbc1d24 UTSW 17 24185780 missense possibly damaging 0.95
R6893:Tbc1d24 UTSW 17 24182518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGAGAGCTGAGTCCGC -3'
(R):5'- CTCCTAAGCCATTTGGACATTC -3'

Sequencing Primer
(F):5'- AGCTTGCAGATTCAGGCG -3'
(R):5'- CTAAGCCATTTGGACATTCTATGC -3'
Posted On2014-08-25