Incidental Mutation 'R0140:Blnk'
ID22289
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene NameB cell linker
SynonymsBASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
MMRRC Submission 038425-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0140 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location40928927-40994535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40940224 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 285 (S285T)
Ref Sequence ENSEMBL: ENSMUSP00000057844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
PDB Structure
Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000054769
AA Change: S285T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: S285T

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117695
AA Change: S285T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: S285T

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma.
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably null Het
9330161L09Rik T C 12: 103,407,328 E95G unknown Het
Abca2 T G 2: 25,438,085 probably null Het
Adgrf3 T C 5: 30,196,381 K13R probably benign Het
Arhgap15 C A 2: 44,322,767 F416L probably damaging Het
Arhgef26 C G 3: 62,448,245 T746R probably benign Het
Aspm C T 1: 139,480,641 T2422I probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
AY358078 T A 14: 51,825,942 D348E probably benign Het
Calr3 C T 8: 72,434,888 noncoding transcript Het
Camsap2 A T 1: 136,280,382 V1130D probably benign Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Ccdc69 C A 11: 55,050,499 C196F possibly damaging Het
Cdhr3 T G 12: 33,080,413 N141T probably benign Het
Cdk4 T C 10: 127,064,345 V37A probably damaging Het
Celsr2 C T 3: 108,397,933 R2110K probably benign Het
Clcn7 A G 17: 25,153,754 Y457C probably damaging Het
Col6a6 A G 9: 105,702,275 F1917S probably damaging Het
Cps1 T G 1: 67,180,116 S872A probably benign Het
Crebbp G T 16: 4,117,499 T842N probably damaging Het
Dennd2d G A 3: 106,492,483 V234I probably benign Het
Fam227b T C 2: 126,124,603 M130V possibly damaging Het
Fbxw24 G T 9: 109,605,414 L373I possibly damaging Het
Fubp3 T C 2: 31,608,184 Y359H probably damaging Het
Gm19684 T C 17: 36,127,427 I37T unknown Het
Hrnr C T 3: 93,331,493 Q3013* probably null Het
Il12rb1 T C 8: 70,819,771 noncoding transcript Het
Lepr A T 4: 101,768,067 D473V probably damaging Het
Myof A T 19: 37,951,556 Y820* probably null Het
Nfil3 G A 13: 52,967,645 Q408* probably null Het
Nolc1 G A 19: 46,081,378 D236N unknown Het
Npbwr1 A C 1: 5,916,621 Y225D probably damaging Het
Nrip3 T C 7: 109,761,815 noncoding transcript Het
Ntrk1 A C 3: 87,778,568 L749R probably damaging Het
Olfr1115 A G 2: 87,252,625 I229M probably damaging Het
Olfr1261 T A 2: 89,994,119 V242D probably damaging Het
Olfr222 A G 11: 59,570,978 L254P probably damaging Het
Olfr628 A G 7: 103,732,142 D72G probably damaging Het
Olfr801 G T 10: 129,669,688 T277N probably damaging Het
Paox A T 7: 140,134,058 T244S probably damaging Het
Pcdhb9 T A 18: 37,402,961 D669E possibly damaging Het
Pggt1b A G 18: 46,258,083 probably null Het
Phkg1 T A 5: 129,864,608 I334F probably benign Het
Phtf1 A T 3: 103,987,560 R208W probably null Het
Pnliprp2 A T 19: 58,766,363 I280F probably benign Het
Pnmal1 A G 7: 16,960,222 M1V probably null Het
Prcp A G 7: 92,928,611 T328A probably damaging Het
Pxdn A G 12: 29,982,754 E179G probably benign Het
Racgap1 A T 15: 99,623,651 N541K probably benign Het
Rnf103 T A 6: 71,509,331 F315L possibly damaging Het
Sept2 A G 1: 93,501,639 R237G probably damaging Het
Setd6 T A 8: 95,716,109 L58Q probably damaging Het
Sipa1l1 G A 12: 82,396,200 V755I probably damaging Het
Slc16a12 G T 19: 34,672,704 probably benign Het
Slk G A 19: 47,622,335 D815N probably damaging Het
Stx1a T C 5: 135,045,585 noncoding transcript Het
Tbc1d15 T A 10: 115,220,219 I283F probably damaging Het
Tenm4 T C 7: 96,896,052 I2425T possibly damaging Het
Tle1 G A 4: 72,120,185 H702Y probably damaging Het
Tmc6 A G 11: 117,766,251 S809P unknown Het
Tmem268 G A 4: 63,577,859 R179H possibly damaging Het
Tmem9 A G 1: 136,034,162 K165R probably damaging Het
Trpm6 A G 19: 18,819,194 probably null Het
Tufm C T 7: 126,489,831 P369S probably damaging Het
Ubqln1 A G 13: 58,193,289 I216T probably damaging Het
Urad T G 5: 147,322,331 M1L probably benign Het
Utp6 A G 11: 79,956,725 noncoding transcript Het
Vav2 C T 2: 27,273,676 noncoding transcript Het
Vmn2r55 G T 7: 12,668,177 Q395K possibly damaging Het
Wwox T G 8: 114,706,287 V231G probably damaging Het
Zfp646 T A 7: 127,883,506 N1618K probably benign Het
Zzef1 G A 11: 72,899,551 M2110I possibly damaging Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 unclassified noncoding transcript
busy UTSW 19 40952391 nonsense
IGL02988:Blnk UTSW 19 40929216 missense probably damaging 1.00
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1638:Blnk UTSW 19 40937678 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site unknown
R2880:Blnk UTSW 19 40962455 missense probably damaging 1.00
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5421:Blnk UTSW 19 40968523 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6320:Blnk UTSW 19 40934459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACCGATTCCCTGTGCGAG -3'
(R):5'- ATGGACCTGTACCACTGTGGGAAG -3'

Sequencing Primer
(F):5'- acagacagacagacaaacaaac -3'
(R):5'- AGGGAGTCTCGGTCCTAAG -3'
Posted OnApr 16, 2013