Incidental Mutation 'R2016:Olfr1133'
ID222952
Institutional Source Beutler Lab
Gene Symbol Olfr1133
Ensembl Gene ENSMUSG00000075155
Gene Nameolfactory receptor 1133
SynonymsGA_x6K02T2Q125-49151278-49150337, MOR176-2
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87645180-87647374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87646052 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 24 (V24M)
Ref Sequence ENSEMBL: ENSMUSP00000149460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099855] [ENSMUST00000217368]
Predicted Effect probably benign
Transcript: ENSMUST00000099855
AA Change: V24M

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097441
Gene: ENSMUSG00000075155
AA Change: V24M

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:7tm_4 32 308 7e-51 PFAM
Pfam:7tm_1 42 291 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217368
AA Change: V24M

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Olfr1133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Olfr1133 APN 2 87645286 missense probably damaging 1.00
IGL03354:Olfr1133 APN 2 87645595 missense probably damaging 0.99
PIT4366001:Olfr1133 UTSW 2 87645190 nonsense probably null
R1375:Olfr1133 UTSW 2 87645737 missense probably damaging 1.00
R1413:Olfr1133 UTSW 2 87645838 missense probably benign 0.02
R2011:Olfr1133 UTSW 2 87645889 missense probably damaging 0.97
R2026:Olfr1133 UTSW 2 87645409 missense probably damaging 1.00
R2106:Olfr1133 UTSW 2 87645551 missense probably damaging 1.00
R4393:Olfr1133 UTSW 2 87645912 nonsense probably null
R5292:Olfr1133 UTSW 2 87645995 missense probably damaging 1.00
R5562:Olfr1133 UTSW 2 87645719 missense probably benign 0.00
R5631:Olfr1133 UTSW 2 87645608 missense probably benign 0.16
R5632:Olfr1133 UTSW 2 87645229 missense probably damaging 1.00
R6801:Olfr1133 UTSW 2 87645323 missense probably benign 0.23
R7014:Olfr1133 UTSW 2 87645976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACATCTGCAAAGGCCC -3'
(R):5'- TCCTTCTGTCAAAGGCAAATACC -3'

Sequencing Primer
(F):5'- ATCAGCCAGCATCTTTGGAG -3'
(R):5'- GGCAAATACCAAGAATCTGACTATG -3'
Posted On2014-08-25