Incidental Mutation 'R2016:Nr4a3'
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48083252 bp
Amino Acid Change Cysteine to Tyrosine at position 595 (C595Y)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: C595Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: C595Y

Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153369
AA Change: C624Y
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: C624Y

Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25