Incidental Mutation 'R2016:Col4a2'
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
MMRRC Submission 040025-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11445086 bp
Amino Acid Change Phenylalanine to Leucine at position 1515 (F1515L)
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033899]
Predicted Effect probably benign
Transcript: ENSMUST00000033899
AA Change: F1515L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: F1515L

signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146219
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25