Incidental Mutation 'R1989:Olfr622'
ID223029
Institutional Source Beutler Lab
Gene Symbol Olfr622
Ensembl Gene ENSMUSG00000050085
Gene Nameolfactory receptor 622
SynonymsMOR26-1, GA_x6K02T2PBJ9-6362863-6361910
MMRRC Submission 040001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1989 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103638451-103642702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103639495 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 215 (I215K)
Ref Sequence ENSEMBL: ENSMUSP00000151149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058744] [ENSMUST00000213536] [ENSMUST00000216570]
Predicted Effect probably damaging
Transcript: ENSMUST00000058744
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058312
Gene: ENSMUSG00000050085
AA Change: I215K

DomainStartEndE-ValueType
Pfam:7tm_4 32 312 4.2e-100 PFAM
Pfam:7TM_GPCR_Srsx 36 308 2.3e-6 PFAM
Pfam:7tm_1 42 293 6.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213536
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216337
Predicted Effect probably damaging
Transcript: ENSMUST00000216570
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
Acaca T C 11: 84,262,529 M921T probably damaging Het
Actn2 A T 13: 12,340,395 W36R probably benign Het
Adcy9 A T 16: 4,298,727 V643D probably damaging Het
Agbl4 A T 4: 111,566,682 T302S possibly damaging Het
Akap13 A G 7: 75,704,516 N1795S probably benign Het
Ang T A 14: 51,101,551 C50S probably damaging Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Asxl3 T C 18: 22,452,363 V115A probably damaging Het
B4galt5 A T 2: 167,305,003 W304R probably damaging Het
Bptf T C 11: 107,074,826 K1118E probably damaging Het
Cacna1b T C 2: 24,721,374 Y335C probably damaging Het
Catsperb A T 12: 101,602,711 I881F probably damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Cyp2f2 A G 7: 27,129,203 D90G probably damaging Het
Cyr61 A T 3: 145,647,743 Y355N probably benign Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
E2f8 T C 7: 48,873,280 E349G probably benign Het
Ebf1 T C 11: 44,621,966 M134T probably damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Focad T C 4: 88,232,784 probably null Het
Gabra1 A T 11: 42,155,015 D89E probably damaging Het
Hip1r G T 5: 123,989,698 V90F probably damaging Het
Ifi213 C A 1: 173,568,808 probably null Het
Kcnj9 A G 1: 172,326,149 I136T probably benign Het
Kmt2c A G 5: 25,498,544 S3P possibly damaging Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Lrrk1 G A 7: 66,281,684 S43L probably damaging Het
Macf1 A G 4: 123,497,726 probably null Het
Mad1l1 A G 5: 140,303,670 S167P probably benign Het
Maml3 G T 3: 51,697,758 A64D probably damaging Het
Mgat4c T C 10: 102,378,159 M1T probably null Het
Mkrn2os G T 6: 115,589,350 T88K probably damaging Het
Mob3c T C 4: 115,831,557 Y96H probably damaging Het
Mpo T A 11: 87,803,472 I96N probably damaging Het
Mup17 T A 4: 61,593,623 Y138F probably benign Het
Myh8 A G 11: 67,292,724 I754V probably benign Het
Naa30 T A 14: 49,178,140 L289* probably null Het
Nap1l4 A C 7: 143,527,184 F292V probably damaging Het
Nek5 T A 8: 22,111,169 N129Y probably damaging Het
Nlrp9a A G 7: 26,573,913 E880G probably benign Het
Nsun6 G T 2: 15,038,184 N155K probably benign Het
Olfr1189 T A 2: 88,592,599 I265K probably damaging Het
Olfr1318 T A 2: 112,156,377 I142N probably benign Het
Olfr170 A T 16: 19,606,657 Y4N probably benign Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr930 T C 9: 38,930,875 S235P possibly damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Ppp2r5d C T 17: 46,684,099 V559M probably benign Het
Ptgfr A T 3: 151,835,339 Y177* probably null Het
Rnase10 A T 14: 51,009,638 I121L probably benign Het
Sall2 G A 14: 52,314,439 P431L probably damaging Het
Sbf2 A G 7: 110,348,923 V1194A possibly damaging Het
Scimp T C 11: 70,791,576 K105E possibly damaging Het
Scrt2 A T 2: 152,082,087 D13V probably damaging Het
Snx19 A G 9: 30,428,108 S181G possibly damaging Het
Spata2 G A 2: 167,484,314 T195M possibly damaging Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srpk2 G A 5: 23,518,423 A565V probably damaging Het
Stard9 A G 2: 120,701,406 I2715V probably benign Het
Sval1 A G 6: 41,955,491 T92A possibly damaging Het
Synrg T C 11: 84,019,955 probably null Het
Tlr12 T C 4: 128,617,069 T463A probably benign Het
Tnxb A G 17: 34,683,377 H945R probably benign Het
Tnxb A T 17: 34,693,885 D1791V probably damaging Het
Topaz1 C T 9: 122,750,125 T700I possibly damaging Het
Trappc8 A G 18: 20,845,651 V796A probably benign Het
Trpm1 A T 7: 64,209,032 probably null Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ttn T A 2: 76,750,941 N23203Y probably damaging Het
Ttn A T 2: 76,770,787 Y18781N probably damaging Het
Tuba3a T C 6: 125,281,253 N258S probably damaging Het
Upk1b A T 16: 38,784,241 W141R possibly damaging Het
Vars T C 17: 35,011,838 F567L possibly damaging Het
Vcpip1 G C 1: 9,745,563 A865G probably benign Het
Vmn2r22 A T 6: 123,637,541 F363L probably damaging Het
Vmn2r66 A T 7: 85,011,993 F10I probably benign Het
Wbp2 C T 11: 116,080,221 probably null Het
Yy1 T C 12: 108,806,608 L270P probably damaging Het
Zan A T 5: 137,420,006 C2943* probably null Het
Zfp51 T A 17: 21,456,320 Y18N possibly damaging Het
Other mutations in Olfr622
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Olfr622 APN 7 103639832 missense probably damaging 1.00
IGL02972:Olfr622 APN 7 103639894 missense probably damaging 1.00
PIT4434001:Olfr622 UTSW 7 103639847 missense probably damaging 1.00
R1487:Olfr622 UTSW 7 103639594 missense probably damaging 1.00
R3880:Olfr622 UTSW 7 103639624 missense probably benign 0.33
R4595:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R4989:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R5715:Olfr622 UTSW 7 103639802 missense probably damaging 1.00
R5840:Olfr622 UTSW 7 103639256 missense probably benign 0.05
R6046:Olfr622 UTSW 7 103639679 missense probably benign 0.01
R6207:Olfr622 UTSW 7 103640002 missense probably benign 0.29
R6294:Olfr622 UTSW 7 103639591 missense probably damaging 1.00
R6392:Olfr622 UTSW 7 103639682 missense probably benign
R6522:Olfr622 UTSW 7 103639297 missense probably damaging 1.00
R6996:Olfr622 UTSW 7 103639858 missense probably benign 0.10
R7069:Olfr622 UTSW 7 103639960 missense probably damaging 0.99
X0018:Olfr622 UTSW 7 103639598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGATTAACCGCAGAAGG -3'
(R):5'- TGCCATGCCCTATTCTGATTAAG -3'

Sequencing Primer
(F):5'- GGTACTAAAAGGTACATGCTTGC -3'
(R):5'- CATGCCCTATTCTGATTAAGAGGCTG -3'
Posted On2014-08-25