Incidental Mutation 'R2016:Midn'
ID223048
Institutional Source Beutler Lab
Gene Symbol Midn
Ensembl Gene ENSMUSG00000035621
Gene Namemidnolin
Synonyms
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R2016 (G1)
Quality Score136
Status Not validated
Chromosome10
Chromosomal Location80148272-80158368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80150115 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 13 (R13L)
Ref Sequence ENSEMBL: ENSMUSP00000115717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003156] [ENSMUST00000042057] [ENSMUST00000099492] [ENSMUST00000105366] [ENSMUST00000105367] [ENSMUST00000144526] [ENSMUST00000146516] [ENSMUST00000151202] [ENSMUST00000153477]
Predicted Effect probably benign
Transcript: ENSMUST00000003156
SMART Domains Protein: ENSMUSP00000003156
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 119 2.2e-21 PFAM
low complexity region 144 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042057
AA Change: R13L

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046967
Gene: ENSMUSG00000035621
AA Change: R13L

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 130 143 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 238 262 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 434 453 N/A INTRINSIC
low complexity region 465 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099492
AA Change: R13L

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097091
Gene: ENSMUSG00000035621
AA Change: R13L

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 154 168 N/A INTRINSIC
low complexity region 195 219 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105366
SMART Domains Protein: ENSMUSP00000101005
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 103 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105367
SMART Domains Protein: ENSMUSP00000101006
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 119 2.2e-21 PFAM
low complexity region 144 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124179
Predicted Effect probably benign
Transcript: ENSMUST00000144526
SMART Domains Protein: ENSMUSP00000120988
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146516
SMART Domains Protein: ENSMUSP00000119962
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 88 112 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151202
AA Change: R13L

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115717
Gene: ENSMUSG00000035621
AA Change: R13L

DomainStartEndE-ValueType
Blast:UBQ 32 67 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153477
SMART Domains Protein: ENSMUSP00000119787
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains an ubiquitin-like domain. This protein may be involved in the regulation of brain development as inferred by its high expression level in the embryonic midbrain. This protein has been found to negatively regulate glucokinase activity and insulin secretion in pancreatic beta cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate and small ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Midn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Midn APN 10 80156643 unclassified probably benign
IGL01969:Midn APN 10 80155259 missense probably benign 0.00
IGL02824:Midn APN 10 80153652 missense possibly damaging 0.91
Midnight UTSW 10 80154457 missense probably damaging 0.98
Sepia UTSW 10 80151404 missense probably null 0.26
R0684:Midn UTSW 10 80156502 missense probably damaging 1.00
R1517:Midn UTSW 10 80154123 missense probably damaging 0.96
R1926:Midn UTSW 10 80151661 missense probably damaging 1.00
R2004:Midn UTSW 10 80155149 missense probably benign 0.13
R2340:Midn UTSW 10 80150112 missense possibly damaging 0.66
R2483:Midn UTSW 10 80150310 missense probably benign 0.16
R3622:Midn UTSW 10 80150310 missense probably benign 0.16
R3624:Midn UTSW 10 80150310 missense probably benign 0.16
R4296:Midn UTSW 10 80151719 missense probably damaging 1.00
R4740:Midn UTSW 10 80151404 missense probably null 0.26
R4930:Midn UTSW 10 80155355 missense probably benign
R4977:Midn UTSW 10 80150184 missense probably damaging 1.00
R5423:Midn UTSW 10 80155193 missense probably benign 0.15
R6149:Midn UTSW 10 80154457 missense probably damaging 0.98
R6542:Midn UTSW 10 80156584 missense probably damaging 0.97
R6826:Midn UTSW 10 80154127 nonsense probably null
R7478:Midn UTSW 10 80155322 missense possibly damaging 0.53
X0018:Midn UTSW 10 80153997 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGCCGGCTCAATTCCTAACG -3'
(R):5'- CGTGTCTTTGTGAAGCAGC -3'

Sequencing Primer
(F):5'- GGCTCAATTCCTAACGTTGGGAC -3'
(R):5'- TCTTTGTGAAGCAGCGCCAG -3'
Posted On2014-08-25