Incidental Mutation 'R1989:Myh8'
ID223061
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 040001-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R1989 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67292724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 754 (I754V)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: I754V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: I754V

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
Acaca T C 11: 84,262,529 M921T probably damaging Het
Actn2 A T 13: 12,340,395 W36R probably benign Het
Adcy9 A T 16: 4,298,727 V643D probably damaging Het
Agbl4 A T 4: 111,566,682 T302S possibly damaging Het
Akap13 A G 7: 75,704,516 N1795S probably benign Het
Ang T A 14: 51,101,551 C50S probably damaging Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Asxl3 T C 18: 22,452,363 V115A probably damaging Het
B4galt5 A T 2: 167,305,003 W304R probably damaging Het
Bptf T C 11: 107,074,826 K1118E probably damaging Het
Cacna1b T C 2: 24,721,374 Y335C probably damaging Het
Catsperb A T 12: 101,602,711 I881F probably damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Cyp2f2 A G 7: 27,129,203 D90G probably damaging Het
Cyr61 A T 3: 145,647,743 Y355N probably benign Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
E2f8 T C 7: 48,873,280 E349G probably benign Het
Ebf1 T C 11: 44,621,966 M134T probably damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Focad T C 4: 88,232,784 probably null Het
Gabra1 A T 11: 42,155,015 D89E probably damaging Het
Hip1r G T 5: 123,989,698 V90F probably damaging Het
Ifi213 C A 1: 173,568,808 probably null Het
Kcnj9 A G 1: 172,326,149 I136T probably benign Het
Kmt2c A G 5: 25,498,544 S3P possibly damaging Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Lrrk1 G A 7: 66,281,684 S43L probably damaging Het
Macf1 A G 4: 123,497,726 probably null Het
Mad1l1 A G 5: 140,303,670 S167P probably benign Het
Maml3 G T 3: 51,697,758 A64D probably damaging Het
Mgat4c T C 10: 102,378,159 M1T probably null Het
Mkrn2os G T 6: 115,589,350 T88K probably damaging Het
Mob3c T C 4: 115,831,557 Y96H probably damaging Het
Mpo T A 11: 87,803,472 I96N probably damaging Het
Mup17 T A 4: 61,593,623 Y138F probably benign Het
Naa30 T A 14: 49,178,140 L289* probably null Het
Nap1l4 A C 7: 143,527,184 F292V probably damaging Het
Nek5 T A 8: 22,111,169 N129Y probably damaging Het
Nlrp9a A G 7: 26,573,913 E880G probably benign Het
Nsun6 G T 2: 15,038,184 N155K probably benign Het
Olfr1189 T A 2: 88,592,599 I265K probably damaging Het
Olfr1318 T A 2: 112,156,377 I142N probably benign Het
Olfr170 A T 16: 19,606,657 Y4N probably benign Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr622 A T 7: 103,639,495 I215K probably damaging Het
Olfr930 T C 9: 38,930,875 S235P possibly damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Ppp2r5d C T 17: 46,684,099 V559M probably benign Het
Ptgfr A T 3: 151,835,339 Y177* probably null Het
Rnase10 A T 14: 51,009,638 I121L probably benign Het
Sall2 G A 14: 52,314,439 P431L probably damaging Het
Sbf2 A G 7: 110,348,923 V1194A possibly damaging Het
Scimp T C 11: 70,791,576 K105E possibly damaging Het
Scrt2 A T 2: 152,082,087 D13V probably damaging Het
Snx19 A G 9: 30,428,108 S181G possibly damaging Het
Spata2 G A 2: 167,484,314 T195M possibly damaging Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srpk2 G A 5: 23,518,423 A565V probably damaging Het
Stard9 A G 2: 120,701,406 I2715V probably benign Het
Sval1 A G 6: 41,955,491 T92A possibly damaging Het
Synrg T C 11: 84,019,955 probably null Het
Tlr12 T C 4: 128,617,069 T463A probably benign Het
Tnxb A G 17: 34,683,377 H945R probably benign Het
Tnxb A T 17: 34,693,885 D1791V probably damaging Het
Topaz1 C T 9: 122,750,125 T700I possibly damaging Het
Trappc8 A G 18: 20,845,651 V796A probably benign Het
Trpm1 A T 7: 64,209,032 probably null Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ttn T A 2: 76,750,941 N23203Y probably damaging Het
Ttn A T 2: 76,770,787 Y18781N probably damaging Het
Tuba3a T C 6: 125,281,253 N258S probably damaging Het
Upk1b A T 16: 38,784,241 W141R possibly damaging Het
Vars T C 17: 35,011,838 F567L possibly damaging Het
Vcpip1 G C 1: 9,745,563 A865G probably benign Het
Vmn2r22 A T 6: 123,637,541 F363L probably damaging Het
Vmn2r66 A T 7: 85,011,993 F10I probably benign Het
Wbp2 C T 11: 116,080,221 probably null Het
Yy1 T C 12: 108,806,608 L270P probably damaging Het
Zan A T 5: 137,420,006 C2943* probably null Het
Zfp51 T A 17: 21,456,320 Y18N possibly damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTCCTCTTTGCCGAATAG -3'
(R):5'- ATCTGGGCCAGCTTTTCATC -3'

Sequencing Primer
(F):5'- CCTCTTTGCCGAATAGCATTAAATG -3'
(R):5'- CTCTCATTTCTTCCAGGAGACCCAG -3'
Posted On2014-08-25