Incidental Mutation 'R1989:Actn2'
ID223078
Institutional Source Beutler Lab
Gene Symbol Actn2
Ensembl Gene ENSMUSG00000052374
Gene Nameactinin alpha 2
Synonyms
MMRRC Submission 040001-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R1989 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12269426-12340760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12340395 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 36 (W36R)
Ref Sequence ENSEMBL: ENSMUSP00000129609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193]
Predicted Effect probably benign
Transcript: ENSMUST00000064204
AA Change: W36R

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: W36R

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 2e-16 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110616
SMART Domains Protein: ENSMUSP00000106246
Gene: ENSMUSG00000052374

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168193
AA Change: W36R

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: W36R

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 7e-18 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
Acaca T C 11: 84,262,529 M921T probably damaging Het
Adcy9 A T 16: 4,298,727 V643D probably damaging Het
Agbl4 A T 4: 111,566,682 T302S possibly damaging Het
Akap13 A G 7: 75,704,516 N1795S probably benign Het
Ang T A 14: 51,101,551 C50S probably damaging Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Asxl3 T C 18: 22,452,363 V115A probably damaging Het
B4galt5 A T 2: 167,305,003 W304R probably damaging Het
Bptf T C 11: 107,074,826 K1118E probably damaging Het
Cacna1b T C 2: 24,721,374 Y335C probably damaging Het
Catsperb A T 12: 101,602,711 I881F probably damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Cyp2f2 A G 7: 27,129,203 D90G probably damaging Het
Cyr61 A T 3: 145,647,743 Y355N probably benign Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
E2f8 T C 7: 48,873,280 E349G probably benign Het
Ebf1 T C 11: 44,621,966 M134T probably damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Focad T C 4: 88,232,784 probably null Het
Gabra1 A T 11: 42,155,015 D89E probably damaging Het
Hip1r G T 5: 123,989,698 V90F probably damaging Het
Ifi213 C A 1: 173,568,808 probably null Het
Kcnj9 A G 1: 172,326,149 I136T probably benign Het
Kmt2c A G 5: 25,498,544 S3P possibly damaging Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Lrrk1 G A 7: 66,281,684 S43L probably damaging Het
Macf1 A G 4: 123,497,726 probably null Het
Mad1l1 A G 5: 140,303,670 S167P probably benign Het
Maml3 G T 3: 51,697,758 A64D probably damaging Het
Mgat4c T C 10: 102,378,159 M1T probably null Het
Mkrn2os G T 6: 115,589,350 T88K probably damaging Het
Mob3c T C 4: 115,831,557 Y96H probably damaging Het
Mpo T A 11: 87,803,472 I96N probably damaging Het
Mup17 T A 4: 61,593,623 Y138F probably benign Het
Myh8 A G 11: 67,292,724 I754V probably benign Het
Naa30 T A 14: 49,178,140 L289* probably null Het
Nap1l4 A C 7: 143,527,184 F292V probably damaging Het
Nek5 T A 8: 22,111,169 N129Y probably damaging Het
Nlrp9a A G 7: 26,573,913 E880G probably benign Het
Nsun6 G T 2: 15,038,184 N155K probably benign Het
Olfr1189 T A 2: 88,592,599 I265K probably damaging Het
Olfr1318 T A 2: 112,156,377 I142N probably benign Het
Olfr170 A T 16: 19,606,657 Y4N probably benign Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr622 A T 7: 103,639,495 I215K probably damaging Het
Olfr930 T C 9: 38,930,875 S235P possibly damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Ppp2r5d C T 17: 46,684,099 V559M probably benign Het
Ptgfr A T 3: 151,835,339 Y177* probably null Het
Rnase10 A T 14: 51,009,638 I121L probably benign Het
Sall2 G A 14: 52,314,439 P431L probably damaging Het
Sbf2 A G 7: 110,348,923 V1194A possibly damaging Het
Scimp T C 11: 70,791,576 K105E possibly damaging Het
Scrt2 A T 2: 152,082,087 D13V probably damaging Het
Snx19 A G 9: 30,428,108 S181G possibly damaging Het
Spata2 G A 2: 167,484,314 T195M possibly damaging Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srpk2 G A 5: 23,518,423 A565V probably damaging Het
Stard9 A G 2: 120,701,406 I2715V probably benign Het
Sval1 A G 6: 41,955,491 T92A possibly damaging Het
Synrg T C 11: 84,019,955 probably null Het
Tlr12 T C 4: 128,617,069 T463A probably benign Het
Tnxb A G 17: 34,683,377 H945R probably benign Het
Tnxb A T 17: 34,693,885 D1791V probably damaging Het
Topaz1 C T 9: 122,750,125 T700I possibly damaging Het
Trappc8 A G 18: 20,845,651 V796A probably benign Het
Trpm1 A T 7: 64,209,032 probably null Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ttn T A 2: 76,750,941 N23203Y probably damaging Het
Ttn A T 2: 76,770,787 Y18781N probably damaging Het
Tuba3a T C 6: 125,281,253 N258S probably damaging Het
Upk1b A T 16: 38,784,241 W141R possibly damaging Het
Vars T C 17: 35,011,838 F567L possibly damaging Het
Vcpip1 G C 1: 9,745,563 A865G probably benign Het
Vmn2r22 A T 6: 123,637,541 F363L probably damaging Het
Vmn2r66 A T 7: 85,011,993 F10I probably benign Het
Wbp2 C T 11: 116,080,221 probably null Het
Yy1 T C 12: 108,806,608 L270P probably damaging Het
Zan A T 5: 137,420,006 C2943* probably null Het
Zfp51 T A 17: 21,456,320 Y18N possibly damaging Het
Other mutations in Actn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Actn2 APN 13 12310910 missense possibly damaging 0.50
IGL01909:Actn2 APN 13 12309593 critical splice donor site probably null
IGL01994:Actn2 APN 13 12290677 missense probably benign 0.26
IGL02118:Actn2 APN 13 12276547 intron probably benign
IGL02480:Actn2 APN 13 12276478 missense probably benign 0.02
IGL02827:Actn2 APN 13 12275199 missense probably damaging 1.00
IGL03110:Actn2 APN 13 12309607 missense probably benign 0.02
R0044:Actn2 UTSW 13 12275127 missense possibly damaging 0.51
R0512:Actn2 UTSW 13 12277415 missense probably damaging 1.00
R1623:Actn2 UTSW 13 12340439 missense probably benign
R1983:Actn2 UTSW 13 12278810 missense probably benign 0.00
R2148:Actn2 UTSW 13 12300949 missense probably damaging 0.99
R2196:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R2254:Actn2 UTSW 13 12296479 missense probably benign 0.20
R2850:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R4391:Actn2 UTSW 13 12290748 missense probably damaging 0.99
R4396:Actn2 UTSW 13 12310879 missense probably damaging 1.00
R4758:Actn2 UTSW 13 12288586 nonsense probably null
R5068:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5069:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5070:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5228:Actn2 UTSW 13 12288659 critical splice acceptor site probably null
R5382:Actn2 UTSW 13 12308951 missense probably benign 0.37
R5408:Actn2 UTSW 13 12270795 missense probably benign 0.41
R5975:Actn2 UTSW 13 12340497 missense probably benign 0.43
R6189:Actn2 UTSW 13 12276440 missense probably damaging 1.00
R6226:Actn2 UTSW 13 12278967 missense probably benign
R6498:Actn2 UTSW 13 12276473 missense probably damaging 1.00
R7094:Actn2 UTSW 13 12309657 missense probably damaging 1.00
R7164:Actn2 UTSW 13 12278961 missense probably damaging 1.00
R7218:Actn2 UTSW 13 12278913 missense probably benign 0.33
R7260:Actn2 UTSW 13 12276490 missense probably benign 0.00
X0018:Actn2 UTSW 13 12269645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTATCTCTGGGTGTGC -3'
(R):5'- GAACCGCGAGAAGGTCACC -3'

Sequencing Primer
(F):5'- CTATCTCTGGGTGTGCTGTCC -3'
(R):5'- AGAAGGTCACCGCAGCC -3'
Posted On2014-08-25