Incidental Mutation 'R2002:S1pr1'
ID223156
Institutional Source Beutler Lab
Gene Symbol S1pr1
Ensembl Gene ENSMUSG00000045092
Gene Namesphingosine-1-phosphate receptor 1
SynonymsS1P1, S1P, Edg1
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location115710433-115715072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115712895 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 17 (S17P)
Ref Sequence ENSEMBL: ENSMUSP00000050897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055676]
Predicted Effect probably benign
Transcript: ENSMUST00000055676
AA Change: S17P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000050897
Gene: ENSMUSG00000045092
AA Change: S17P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 326 1.6e-9 PFAM
Pfam:7tm_1 62 311 1.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206983
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: This gene encodes a G-protein-coupled receptor bound by the lysophospholipid, sphingosine 1-phosphate. The gene product functions in endothelial cells and is involved in vascular and heart development. This receptor is highly expressed in T and B lymphocytes, and it plays a role in T cell and B cell export from peripheral lymphoid organs. This protein is bound and downregulated by FTY720, an exogenous immunosuppressant drug studied in mouse disease models for multiple sclerosis in humans. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted mutations exhibit vascular defects resulting in embryonic hemorrhaging and lethality by embryonic day 14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in S1pr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02635:S1pr1 APN 3 115712090 missense probably benign
IGL02698:S1pr1 APN 3 115712097 nonsense probably null
IGL03038:S1pr1 APN 3 115712694 missense possibly damaging 0.74
Jammed UTSW 3 115711803 missense possibly damaging 0.83
Stau UTSW 3 115712061 missense probably damaging 1.00
R1753:S1pr1 UTSW 3 115711938 missense probably benign
R5819:S1pr1 UTSW 3 115712140 nonsense probably null
R6571:S1pr1 UTSW 3 115711803 missense possibly damaging 0.83
R6784:S1pr1 UTSW 3 115712061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATAGTACATGGGCCGG -3'
(R):5'- AAGGCTGCTGTTTCTCGGAG -3'

Sequencing Primer
(F):5'- TACATGGGCCGGTGGAACTTC -3'
(R):5'- GCTGTTTCTCGGAGGCCTC -3'
Posted On2014-08-25