Incidental Mutation 'R2002:Mkrn1'
ID223188
Institutional Source Beutler Lab
Gene Symbol Mkrn1
Ensembl Gene ENSMUSG00000029922
Gene Namemakorin, ring finger protein, 1
Synonyms
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39397804-39420462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39405803 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000031985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031985] [ENSMUST00000051671] [ENSMUST00000114822] [ENSMUST00000114823] [ENSMUST00000146785]
Predicted Effect probably benign
Transcript: ENSMUST00000031985
AA Change: T158A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031985
Gene: ENSMUSG00000029922
AA Change: T158A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 334 2.09e-7 SMART
low complexity region 349 363 N/A INTRINSIC
ZnF_C3H1 366 392 2.53e-2 SMART
Pfam:MKRN1_C 400 479 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051671
AA Change: T158A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084244
Gene: ENSMUSG00000029922
AA Change: T158A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 328 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114822
AA Change: T158A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110470
Gene: ENSMUSG00000029922
AA Change: T158A

DomainStartEndE-ValueType
SCOP:d1gkub1 2 30 3e-3 SMART
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114823
AA Change: T94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110471
Gene: ENSMUSG00000029922
AA Change: T94A

DomainStartEndE-ValueType
ZnF_C3H1 1 17 6.26e1 SMART
ZnF_C3H1 21 46 8.27e-7 SMART
low complexity region 58 78 N/A INTRINSIC
ZnF_C3H1 144 170 1.13e-4 SMART
RING 217 270 2.09e-7 SMART
low complexity region 285 299 N/A INTRINSIC
ZnF_C3H1 302 328 2.53e-2 SMART
low complexity region 378 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122874
Predicted Effect unknown
Transcript: ENSMUST00000122996
AA Change: T172A
SMART Domains Protein: ENSMUSP00000115231
Gene: ENSMUSG00000029922
AA Change: T172A

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 75 96 4.11e-2 SMART
ZnF_C3H1 100 125 8.27e-7 SMART
low complexity region 137 157 N/A INTRINSIC
ZnF_C3H1 223 249 1.13e-4 SMART
RING 296 343 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146785
AA Change: T136A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123440
Gene: ENSMUSG00000029922
AA Change: T136A

DomainStartEndE-ValueType
ZnF_C3H1 34 59 1.56e-2 SMART
ZnF_C3H1 63 88 8.27e-7 SMART
low complexity region 100 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150575
SMART Domains Protein: ENSMUSP00000121563
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
RING 52 105 2.09e-7 SMART
low complexity region 170 191 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and fertile, and show normal kidney morphology, eyelid development, and skeletal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Mkrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Mkrn1 APN 6 39405913 missense possibly damaging 0.80
IGL03235:Mkrn1 APN 6 39401330 missense probably damaging 1.00
R0127:Mkrn1 UTSW 6 39399275 missense probably benign 0.19
R0445:Mkrn1 UTSW 6 39404854 missense probably benign 0.28
R1109:Mkrn1 UTSW 6 39399334 missense probably damaging 1.00
R1366:Mkrn1 UTSW 6 39405917 missense probably benign 0.02
R1783:Mkrn1 UTSW 6 39400456 missense probably null
R4671:Mkrn1 UTSW 6 39405757 missense probably damaging 1.00
R4889:Mkrn1 UTSW 6 39420005 unclassified probably benign
Z1088:Mkrn1 UTSW 6 39400456 missense probably null
Predicted Primers PCR Primer
(F):5'- CCAATCTAATGTGTTGACAGTAGG -3'
(R):5'- AAGAGTCTGGGAGCTCCATGTAG -3'

Sequencing Primer
(F):5'- GTGTTGACAGTAGGTTAAGCTCAAAC -3'
(R):5'- AGCTCCATGTAGCACGATTG -3'
Posted On2014-08-25