Incidental Mutation 'R2002:Olfr139'
ID223224
Institutional Source Beutler Lab
Gene Symbol Olfr139
Ensembl Gene ENSMUSG00000047444
Gene Nameolfactory receptor 139
SynonymsM5, GA_x6K02T2P1NL-4202012-4201065, MOR255-2
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74044033-74056551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74045039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 78 (S78R)
Ref Sequence ENSEMBL: ENSMUSP00000148999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050678] [ENSMUST00000206280] [ENSMUST00000214111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050678
AA Change: S78R

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049558
Gene: ENSMUSG00000047444
AA Change: S78R

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.4e-56 PFAM
Pfam:7TM_GPCR_Srsx 38 276 5.3e-6 PFAM
Pfam:7tm_1 44 293 8.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206280
AA Change: S78R

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214111
AA Change: S78R

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Olfr139
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:Olfr139 UTSW 11 74045118 missense probably damaging 1.00
R0545:Olfr139 UTSW 11 74045047 missense possibly damaging 0.90
R1560:Olfr139 UTSW 11 74044615 missense probably damaging 1.00
R1570:Olfr139 UTSW 11 74044807 missense possibly damaging 0.65
R1781:Olfr139 UTSW 11 74044960 missense probably damaging 1.00
R2857:Olfr139 UTSW 11 74044827 missense possibly damaging 0.93
R2858:Olfr139 UTSW 11 74044827 missense possibly damaging 0.93
R2859:Olfr139 UTSW 11 74044827 missense possibly damaging 0.93
R3874:Olfr139 UTSW 11 74044699 missense probably damaging 1.00
R5023:Olfr139 UTSW 11 74045055 missense probably damaging 1.00
R5057:Olfr139 UTSW 11 74045055 missense probably damaging 1.00
R5242:Olfr139 UTSW 11 74045022 missense possibly damaging 0.89
R5495:Olfr139 UTSW 11 74044785 missense probably damaging 1.00
R5655:Olfr139 UTSW 11 74044334 nonsense probably null
R7220:Olfr139 UTSW 11 74044763 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAAATACCCACCAGTGTGC -3'
(R):5'- TGGCTTAACAGGAAATGTAAGACTG -3'

Sequencing Primer
(F):5'- ACTTCACGGCTCATGCG -3'
(R):5'- GGAAATGTAAGACTGCAACCTATC -3'
Posted On2014-08-25