Incidental Mutation 'R2002:Lmo7'
ID223240
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101887061 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 319 (A319S)
Ref Sequence ENSEMBL: ENSMUSP00000123706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect probably benign
Transcript: ENSMUST00000100337
AA Change: A441S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: A441S

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159026
AA Change: A208S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: A208S

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159258
AA Change: A208S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: A208S

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159314
AA Change: A208S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: A208S

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159597
AA Change: A319S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: A319S

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159797
Predicted Effect probably benign
Transcript: ENSMUST00000159806
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162091
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACCCCGATGACTACTGGTTG -3'
(R):5'- AGTTCACCTTCCCGACACTG -3'

Sequencing Primer
(F):5'- CCCGATGACTACTGGTTGGTCTG -3'
(R):5'- GCAAAATTATATCTCGTTCCACGGC -3'
Posted On2014-08-25